دوره 9، شماره 34 - ( 1-1398 )                   جلد 9 شماره 34 صفحات 93-102 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Azadi M, alsahebfosoul F, Salehi R, Tajbakhsh E, Etemadifar M. Investigation of genetic variation of IL-4 receptor rs1801275 in patients with multiple sclerosis in Isfahan. NCMBJ. 2019; 9 (34) :93-102
URL: http://ncmbjpiau.ir/article-1-1188-fa.html
آزادی مریم، آل صاحب فصول فرشته، صالحی رسول، تاجبخش الهه، اعتمادی فر مسعود. بررسی ارتباط واریانت ژنتیکی rs1801275 گیرنده IL-4 در بیماران مبتلا به مالتیپل اسکلروزیس در شهر اصفهان. مجله تازه هاي بيوتكنولوژي سلولي و مولكولي. 1398; 9 (34) :93-102

URL: http://ncmbjpiau.ir/article-1-1188-fa.html


گروه بیولوژی ملکولی و ژنتیک دانشکده پزشکی، دانشگاه علوم پزشکی اصفهان
متن کامل [PDF 444 kb]   (721 دریافت)     |   چکیده (HTML)  (2812 مشاهده)
متن کامل:   (1295 مشاهده)
مقدمه
Text Box: ـــــــــــــــــــــــــــــــــــــــــــــــــ
نویسنده مسئول:
گروه ایمنی شناسی دانشکده پزشکی، دانشگاه علوم پزشکی اصفهان
پست الکترونیکی: alsahebfosoul@med.mui.ac.ir
تاریخ دریافت: ۱۳۹۶/۱۱/۳۰
تاریخ پذیرش: ۱۳۹۷/۶/۱۴
مالتیپل ­اسکلروزیس (MS) [1] یک بیماری التهابی و مزمن سیستم اعصاب مرکزی است که باعث التهاب و تخریب اولیه و ثانویه پایانه­‌های عصبی مثل آکسون‌­ها و میلین­­ها می­شود (5).
بیش­ترین میزان شیوع آن در بالغین 20 تا 40 ساله بالا بوده و زنان 3-2 برابر بیش­تر از مردان در­گیر می‌­شوند (20). یکی از مشکل­های بیماری MS غیر قابل پیش­بینی بودن میزان پیشرفت بیماری است به­طوری­که در برخی از بیماران سیر بیماری سریع است ولی در برخی دیگر سیر بیماری کند و تدریجی است. عقیده بر این است که در اکثریت بیماران، سیر بیماری رابطه مستقیمی با فعالیت واکنش­های سیستم ایمنی علیه میلین­ها یا سایر پایانه‌­های عصبی دارد (11). امروزه بیش ­تر از دو میلیون نفر در سراسر جهان از این بیماری رنج می­‌برند. فقدان اطلاعات دقیق اپیدمیولوژی، دانش ضعیف و ابزار محدود تشخیص بر صحت گزارش آمار بیماری MS در بسیاری از کشورها تأثیر معنی­داری گذاشته است. میزان شیوع بیماری بین 2 تا 160 نفر در هر صد هزار نفر در کشورهای مختلف گزارش شده است. اروپای شمالی و مرکزی، ایتالیا، بخش­‌های میانی آمریکای شمالی، مناطقی با خطر بالا برای MS گزارش شده­اند. شیوع بیماری در نواحی مختلف آسیا نیز متفاوت است (16). در دهه گذشته افزایش شیوع MS در چند کشور آسیایی مانند ایران و ژاپن گزارش شده است. اطلاعات تأیید شده توسط اطلس بین المللی فدراسیون جهانی [2](MSIF) MS شیوع 3 نفر در هر صد هزار نفر را در کشور هند ارائه نموده است. بنا به آخرین آمار، شیوع بیماری در ایران 60-20 نفر در هر صد هزار نفر و در استان اصفهان به­میزان 93 نفر در هر صد هزار نفر گزارش شده است (4). اتیولوژی این بیماری نامشخص است اما عقیده بر این است که بیماری MS مثل دیگر بیماری‌­های خود ایمن از تعامل پیچیده فاکتورهای ژنتیکی و عوامل محیطی منشاء می‌گیرد (17). چندین فاکتور­محیطی مثل عفونت­‌های ویروسی، استرس وضعیت اجتماعی- اقتصادی، مهاجرت، منطقه جغرافیایی، ماه تولد، رژیم غذایی و میزان در معرض بودن نور خورشید (کمبود ویتامین D) در ابتلای بیماری مؤثر شناخته شده­اند (7). از آن­جایی­که نقش چندین ژن در ایجاد بیماری MS شناسایی شده است، محققان بر این باورند که رابطه پیچیده بین ژن­های مستعدکننده و محیط باعث اختلال در مسیرهای التهابی، تخریب میلین­ها و تخریب بافت در سیستم اعصاب مرکزی [3](CNS) می‌­گردد. علامت مشخصه چنین بیماری‌­های پیچیده ژنتیکی، تغییر در تعداد زیادی از ژن‌­ها است که در استعداد ابتلا به بیماری نقش دارند. اعتقاد بر این است که تعامل ژن به ژن (که اثرهای اپی­ستاتیک نامیده می­‌شود) نقش مهمی در پاتوژنز بیماری‌­های پیچیده دارد (19).
پاتوژنز بیماری MS به این صورت است که در فاز اول آنتی­‌ژن‌­های خودی توسط سلول‌­های ارائه دهنده آنتی­ژن (APC)[4] به لنفوسیت­هایT  ارائه شده، این لنفوسیت­‌های T فعال شده از سد مغزی خونی (BBB)[5] عبور کرده به CNS وارد شده، در CNS سلول­های فعال شده، دوباره با آنتی­ژن‌ های خودی برخورد کرده و تحت تأثیر سیتوکین‌­های التهابی مثل IL-6،  IL-7 و  TNFαبه سلول­هایTh1 و Th17 تمایز می­یابد (10). در فاز دوم سیتوکین­‌ها و کموکاین­های تولید شده باعث فعال شدن اولیگودندروسیت­های موضعی و جلب ماکروفاژها می­‌گردد. ماکروفاژها نیز سیتوکین­هایی ترشح می­‌کنند که باعث تخریب غلاف میلین در نورون­‌ها می‌­گردد و چنان­چه این پروسه ادامه یابد، آسیب دائمی به CNS وارد می­‌شود (12). بیماری شامل چهار فنوتایپ مختلف است: [6](RRMS) با عود و بهبود کامل که اکثریت بیماران یعنی حدود 85 درصد را تشکیل می­دهند. (PPMS) [7] با پیشرفت مزمن بیماری مشخص می­شود و شروع بیماری بدون علائم بالینی است. در 10 درصد بیماران، بیماری به این صورت ظاهر می­گردد. [8](SPMS) که با دوره عود شروع شده و پیشرفت مزمن را به­دنبال دارد.  (RPMS)[9] حدود 50 درصد از بیماران را شامل شده و با انواع PPMS و SPMS هم­پوشانی دارد (15). زمینه ژنتیکی مستعد در ابتلا به بیماری MS نقش دارد اگرچه نزدیک به 9/99 درصد از ژنوم دو فرد مشابه است ولی در بین 2/3 میلیارد جفت باز هنوز هم جفت بازهای متفاوتی وجود دارد. انواع مختلفی از پلی‌مورفیسم­ها در ژنوم وجود دارند که شامل 9 SNPها، تکرارها، حذف­ها و درج شدگی­ها هستند. SNP‌ها، واریانت­‌هایی از توالی ژنوم هستند که در اثر تغییر یک نوکلئوتید ایجاد می­شوند. برای این که یک واریانت، SNP محسوب شود، بایستی فراوانی آن در جامعه بیش از ۱ درصد باشد. SNPها ۹۰ درصد واریانت‌­های ژنوم را تشکیل می­دهند و در هر ۱۰۰ تا ۳۰۰ باز، یک SNP وجود دارد و در مناطق کدکننده و غیر کدکننده ژنوم دیده می­شود.  به­طور کلی SNP‌های موجود در ژن­های مختلف ممکن است در مستعد نمودن افراد در ابتلا به یک بیماری مؤثر باشند و این نکته می­تواند در تخمین شانس ابتلای افراد به بیماری­های خاص مورد استفاده قرار گیرد (21). بنابراین با مطالعه پلی­‌مورفیسم­ها تا حدودی ژن­های با بیش­ترین ارتباط در فرآیندهای ایمونولوژیک و پاتوژنزیس بیماری مشخص می­گردد. اینترلوکین 4 (IL-4) یک گلیکو پروتئین با وزن مولکولی 18 کیلو دالتون است که سلول­های Th1 را مهار نموده و در عین حال پاسخ ایمنی از نوع Th2 را القا می‌­کند. به­علاوه اینترلوکین 4، سنتز سایتوکاینی به نام اینترفرون گاما که عامل تأثیرهای مخرب بیماری MS است را مهار می­‌نماید. ژن کدکننده اینترلوکین 4 در انسان بر روی بازوی بلند کروموزوم 5 و در موقعیت 31-21q در بین دسته­ای از ژن­های سایر سایتوکاین­ها قرار دارد. ژن گیرنده اینترلوکین 4 در موقیت 12-11p16 قرار گرفته است و به­عنوان یکی از ژن­‌های مستعد کننده ابتلا به MS است. جانشینی آمینواسید ها به­ویژه از نوع  Missenseمنجر به ایجاد نوعی پلی­مورفیسم تک نوکلئوتیدی می­گردد که در صورت جانشینی آرژینین به جای گلوتامین در موقعیت اسید آمینه 551 تأثیر مهمی در پیام­رسانی گیرنده اینترلوکین 4 دارد (9). در حقیقت این SNP با بیماری­های ایمونولوژیک متعددی که مکانیسمی مشابه MS دارند و وابسته به پاسخ Th1 هستند مانند آسم، حساسیت، دیابت نوع 1 و بیماری بافت همبند ارتباط دارد (23، 18). تفاوت­های نژادی و ژنتیکی بین افراد در پاسخ ایمنی، فعال­سازی، تنظیم و به­کارگیری سلول­های T ممکن است بتواند اختلاف در استعداد ابتلا بیماری را توضیح دهد. امروزه مطالعه بر روی ژن­های دخیل در فرآیند ایمنی مانند ژن­های مؤثر در فعال سازی سلول­های T می­تواند اطلاعات ارزشمندی در رابطه با استعداد ابتلا به بیماری MS و لوکوس­های تعدیل ژنی ارائه نماید. مطالعه پلی­مورفیسم­های موجود در ژن سایتوکاین­ها، یک ابزار مفید جهت آنالیزهای انسان­شناسی به­منظور پیش­بینی استعداد ابتلا به بیماری در جمعیت‌­های خاص است. به­علاوه این موضوع می­تواند تفاوت­های قومی و نژادی مهمی را نشان دهد (8). با توجه به شیوع بالای بیماری MS در ایران به­ویژه در استان اصفهان، ابتلا بیماران در سن جوانی و گروه مولد کار، اشغال تخت­های بیمارستانی و اعمال هزینه­‌های سنگین بر سیستم بهداشتی درمانی کشور و هزینه خانوار، گران قیمت بودن داروی اینترفرون و خروج مقدار زیادی ارز از کشور، بر آن شدیم که پلی­‌مورفیسم rs1801275 ژن گیرنده اینترلوکین 4 را در بیماران مبتلا به RRMS مراجعه کننده به کلینیک مرکز تحقیقات MS استان اصفهان با هدف بررسی ارتباط این واریانت ژنتیکی و احتمال ابتلا به بیماری MS را بررسی نماییم.
روش کار
جمع آوری نمونه، استخراج DNA و طراحی پرایمرها
در مطالعه مورد-شاهدی حاضر 100 نفر بیمار مبتلا به RRMS پس از اخذ رضایت­نامه کتبی از بیماران از کلینیک مرکز درمانگاه MS استان اصفهان انتخاب شدند و از آنان 3 سی­سی خون روی ضد انعقاد EDTA10 جمع­آوری شد. هم­چنین نمونه خون از 100 فرد سالم بدون سابقه ابتلا به بیماری عفونی و التهابی و بیماری­های خود ایمنی (همسان از نظر سن و جنس) مراجعه کننده به سازمان انتقال خون تهیه شد.
سپس DNA ژنومی با استفاده از کیت (Genet Bio -Korea)  بر اساس دستورالعمل کیت استخراج شد. در ادامه پرایمرهای مورد استفاده توسط نرم­افزار Primer 3 طراحی شده و سپس در سایت NCBI بلاست انجام شد و تأیید گردید. پرایمرهای موردنظر به­منظور سنتز به شرکت ژن فناوران سفارش داده شد. پس از سنتز، پرایمرها در دمای 20- درجه سانتی­گراد برای آزمایش­ها نگهداری شد. در جدول 1 مشخصات پرایمرهای مورد استفاده آورده شده است.
 
 
جدول ۱. پرایمرهای مناسب برای پلی­مورفیسم (rs1801275) A/G
  توالی (5´  ͢   3´) طول (bp) دما (°C) CG (%) سایز باند
Forward GCCGAAATGTCCTCCAGCAT 20 50/60 55 214
Reverse TGCTCCACCGCATGTACAA 19 3/57 6/52 214
 
تکنیک HRM Real Time PCR [10]
HRM یک روش جدید و همگن بعد از تکثیر PCR است که در یک سیستم مدار بسته انجام می­شود. مزیت HRM این است که بعد از PCR به الکترفورز نیاز ندارد. این روش آنالیز تغییرهای ژنتیکی (SNPها، موتاسیون­ها و متیلاسیون­ها) در محصول­های PCR را مقدور می­سازد. HRM نمونه­های اسید نوکلئیک را بر اساس توالی، طول و حجم CG متمایز می­سازد. آنالیز HRM شامل تکثیر ژن مورد نظر در قطعه­های bp 80 تاbp 250 در واکنشی است که محتوی رنگ متصل شونده به DNA دو رشته­ای فلورسنت است. بعد از PCR محصول­ها به­تدریج دناتوره (ذوب) شده و نتیجه آن کاهش فلورسنس است. در این روش بررسی تغییرهای فلورسنس محصول­های اساس مطالعه تغییرهای ژنتیکی در محصول­های PCR است. در جدول­های 2 و 3 شرایط بهینه برای PCR و HRM آورده شده است.
جدول 2. شرایط دمایی و برنامه زمانی بهینه جهت انجام آنالیز PCR
سیکل زمان دما مرحله
1 5 دقیقه 94 دناتوره اولیه
  30 ثانیه 94 دناتوره
30 25 ثانیه 58 اتصال
  35 ثانیه 72 گسترش
1 5 دقیقه 72 گسترش نهایی
 
جدول 3. شرایط دمایی و برنامه زمانی بهینه جهت انجام آنالیز HRM
سیکل زمان دما مرحله
  15دقیقه 95 انتظار
40 15 ثانیه 95 دنانوره اولیع
  20 ثانیه 60 اتصال
  20 ثانیه 72 گسترش
 
تکنیک الکتروفورز
قبل از شروع HRM به­منظور ارزیابی DNAهای استخراج شده، Traditional PCR مورد بررسی کیفی قرار گرفت محصول­های تکثیر شده، حاصل از پرایمرها با روش PCR توسط ژل الکترفورز 5/1 در صد بررسی و ژل در  Gel Doc ((Vilber Lourmat قرار داده شد و باندهای DNA مشاهده شد.
روش آنالیز آماری
پس از پایان آزمایش­ها، برای تجزیه و تحلیل آماری ویژگی‌های جمعیتی پلی­‌مورفیسم از فاکتورهای فراوانی آللی، درجه هتروزیگوتی و شاخص [11]PIC استفاده شد. میزان اطلاع دهندگی، گسترش و میزان بیان یک پلی­مورفیسم در یک جمعیت توسط فاکتور ظرفیت اطلاعاتی چند شکلی (PIC) اندازه­گیری می­شود که مقدار آن برای جایگاه­های ژنی در تعادل هاردی واینبرگ در جمعیت تعریف می­شود و به تعداد آلل­ها و هتروزیگوسیتی مارکر بستگی دارد. هم­چنین تعادل هاردی واینبرگ برای پلی­مورفیسم با استفاده از آزمون دقیق فیشر مورد نظر مورد بررسی قرار گرفت. به­علاوه با استفاده از آزمون غیر پارامتریک مربع کای در نرم­افزار SPSS20، مقایسه فراوانی پلی‌مورفیسم rs1801275 بین دو گروه بیمار و کنترل و احتمال ابتلا به بیماری مالتیپل اسکلروزیس با ضریب اطمینان 95 درصد بررسی شد.
یافته ها
در این مطالعه، جمعیت مورد بررسی در دوگروه بیماران مبتلا به مالتیپل اسکلروزیس در بازه سنی 42-21 سال و گروه شاهد در بازه سنی 48-48 مورد مطالعه قرار گرفتند. در این دو گروه ویژگی­های دموگرافیک مثل جنس، وضعیت تأهل، میزان تحصیلات، گروه خونی، شغل، سن ابتلا به بیماری و مدت بیماری مورد بررسی قرار گرفت و نتایج به­دست آمده در جدول 4 برای دو گروه بیمار و شاهد درج گردید.
 
 
جدول4. میانگین و توزیع فراوانی متغیرهای دموگرافیک بیماران مبتلا به MS و گروه شاهد شرکت کننده در پژوهش
 
متغیر
میانگین و انحراف معیار کم­ترین و بیش­ترین مقدار
گروه شاهد گروه بیمار گروه شاهد گروه بیمار
سن(سال)
سن ابتلا به بیمای MS
مدت ابتلا به بیماری MS
32/53±7/53
---
---
5/79±30/38
7/64±25/97
2/34±3/12
19-48
---
---
21-42
22-38
0-7
 
متغیر
تعداد
گروه شاهد
تعداد
گروه بیمار
تعداد
جنسیت
مرد
زن
وضعیت تاهل
مجرد
متاهل
میزان تحصیلات
زیر دیپلم
دیپلم
لیسانس
بالاتر از لیسانس
گروه خونی
 
AB
A
B
O
 
مصرف سیگار
(بله خیر)
 
46
54
 
 
32
68
 
13
49
29
9
 
21
36
29
14
 
36
64
 
38
62
 
 
38
62
 
24
37
32
7
 
25
31
34
10
 
23
77
در ادامه جهت بررسی فراوانی آللی برای پلی­مورفیسم 1801275 rsاز تکنیک PCR استفاده شد نتایج آنالیز PCR برای این پلی­مورفیسم نشان داد که افراد دارای پلی­مورفیسم مذکور دارای باند ژنی به طول 214 جفت باز بر روی ژل آگاروز هستند (شکل 1).

شکل 1. نتایج PCR: چاهک A هموزیگوت سالم (AA)، چاهک B هتروزیگوت (AG) و چاهک C هموزیگوت بیمار (GG) است. چاهک D مارکر bp 100 است.
در این مطالعه جهت بررسی وجود پلی­مورفیسم rs1801275 در توالی نوکلئوتیدی ژن گیرنده اینترلوکین 4 از تکنیک HRM-PCR استفاده شد. در شکل 2 نمودار تغییرهای میزان فلورسانس در بازه­های مختلف دمایی و در شکل­ 3 نمودار نرمال شده تغییرهای میزان فلورسانس در دماهای مختلف نسبت به ژنوتیپ­های طبیعی و جهش یافته  ژن اینترلوکین 4 نشان داده شده است.
 

شکل 2. نمودار نرمال شده تغییرهای میزان فلورسانس در بازه‌­های مختلف دمایی

شکل 3. نمودار نرمال شده تغییرهای میزان فلورسانس در دماهای مختلف نسبت به ژنوتیپ­های مختلف.
یکی از ویژگی­های قابل توجه تکنیک HRM-PCR توانایی بالا در تمایز نمونه­های هتروزیگوت و هموزیگوت است که این کار از طریق نمودارهای Melting curve  صورت می­پذیرد. به­طور معمول در این نمودارها نمونه­های هموزیگوت تنها دارای یک پیک هستند در حالی­که نمونه­های هتروزیگوت دارای دو پیک نزدیک به­هم هستند. در شکل 4 نمودار Melting curve برای ژنوتیپ­های مختلف رسم شده است.

شکل 4. نمودار Melting curve جهت بررسی تمایز بین نمونه‌های هموزیگوت و هتروزیگوت.
پس از انجام آنالیز HRM و بررسی فراوانی ژنوتیپی نمونه­های مختلف، تعدادی از نمونه­ها جهت بررسی صحت نتایج HRM توالی­یابی شدند. نتایج به­دست آمده از توالی­یابی نشان می­دهد که تکنیک HRM-PCR به­خوبی قابلیت تفکیک ژنوتیپی نمونه­ها را داشته و نتایج آن با نتایج حاصل از توالی­یابی در توافق کامل هستند. در شکل 5 و 6 نتیجه توالی­یابی رشته معکوس DNA برای دو نمونه سالم و جهش یافته نشان داده شده است. مقایسه این دو شکل نشان می­دهد که در انتهای توالی نوکلئوتیدی رشته جهش یافته و در محل وقوع پلی­مورفیسم اسید نوکلئیک تیمین (T) به سیتوزین (C) تبدیل می­گردد. که این نتایج با نتایج به­دست آمده از آنالیز HRM-PCR هم­خوانی داشت.
 

شکل 5. نتایج تعیین توالی رشته معکوس DNA برای نمونه فاقد پلی­مورفیسم rs1801275

شکل 6. نتایج تعیین توالی رشته معکوس DNA برای نمونه دارای پلی­مورفسیم rs1801275
بررسی­های آماری
پیش از انجام مقایسه در بین دو گروه از لحاظ فراوانی آللی و ژنوتیپ و بررسی نسبت مشاهده هر یک، ابتدا تعادل هاردی واینبرگ برای پلی­مورفیسم rs1801275 مورد ارزیابی قرار گرفت. مطابق با جدول 5، بررسی تعادل هاردی واینبرگ با استفاده از تست دقیق فیشر برای پلی­مورفیسم rs1801275 نشان داد که مقدار P-Value برای این مارکر در جمعیت مورد مطالعه برابر (P-Value = 0.27) است. بنابراین در سطح اطمینان 95 درصد این مارکر در جمعیت استان اصفهان در تعادل هاردی- واینبرگ قرار دارد.
 
جدول 5. بررسی میزان هتروزیگوسیتی مشاهده شده و قابل انتظار برای پلی­مورفیسم rs1801275
هتروزیگوسیتی هموزیگوسیتی
مشاهده شده مورد انتظار مشاهده شده مورد انتظار
40/0 457/0 60/0 543/0
 
به­علاوه جهت بررسی میزان اطلاع دهندگی پلی­مورفیسم rs1801275 از شاخص اطلاع دهندگی پلی­مورفیسم (PIC) استفاده شد. شاخص اطلاع دهندگی پلی­مورفیسم معیاری برای اندازه­گیری میزان گویا بودن یک پلی­مورفیسم در یک جامعه است و برای پلی­مورفیسم‌های دو آللی حداکثر مقدار آن برابر 375/0 است. این در حالی است که مقادیر شاخص PIC بزرگ­تر از 25/0 نشان دهنده اطلاع دهندگی بالا و گویا بودن یک پلی­مورفیسم در جامعه مورد مطالعه است. شاخص PIC اندازه­گیری شده برای پلی­مورفیسم rs1801275 برابر با 3515/0 است که نشان از گویا بودن این مارکر و اطلاع دهندگی بالای آن در جمعیت انسانی مورد مطالعه است. از سوی دیگر، نتایج حاصل از بررسی ارتباط بین وجود پلی­مورفیسم rs1801275 و ابتلا به بیماری مالتیپل اسکلروزیس مورد مطالعه قرار گرفت. بررسی توالی نوکلئوتیدی با استفاده تکنیک HRM-PCR نشان داد که فراوانی آللی برای پلی­مورفیسم rs1801275 در گروه شاهد و بیمار به­ترتیب برابر با 35 درصد و 51 درصد بوده و شانس مشاهده آلل A در مقایسه با آلل G در گروه بیمار نسبت به گروه شاهد 517/0 برابر بوده است، به بیان دیگر مشاهده آلل G در بیماران نسبت به افراد سالم به­طور معناداری بیش­تر بوده است (جدول 6). بنابراین می­ توان نتیجه گرفت که بین وجود پلی­مورفیسم rs1801275 و احتمال ابتلا به بیماری مالتیپل اسکلروزیس ارتباط معناداری وجود دارد (222/5 χ2=و 022/0P-Value=). از سوی دیگر در بررسی هر یک از ژنوتایپ­های این پلی­مورفیسم مشخض شد که در گروه شاهد 45 درصد از افراد دارای ژنوتیپ طبیعی، 40 درصد هتروزیگوت و 15 درصد دارای ژنوتیپ هموزیگوت برای پلی­مورفیسم rs1801275 هستند در حالی­که در گروه بیماران 20 درصد از افراد دارای ژنوتیپ طبیعی، 58 درصد هتروزیگوت و 22 درصد دارای ژنوتیپ هموزیگوت هستند. بنابراین نسبت شانس مشاهده ژنوتیپ هتروزیگوت در بیماران و افراد سالم در مقایسه با ژنوتیپ هموزیگوت یکسان بوده و اختلاف معناداری نداشته است ولی به­طور قابل ملاحظه و معناداری شانس مشاهده ژنوتیپ طبیعی در افراد بیمار نسبت به افراد سالم کم­تر بوده است (006/0P_Value=، 303/0OR=).
 
 
جدول 6. بررسی فراوانی آللی پلی‌مورفیسم rs1801275 با استفاده از نتایج حاصل از تکنیک HRM-PCR
پلی مورفیسم گروه شاهد گروه مورد OR (CI 95%) سطح معناداری
A 65(65%) 49(49%) (913/0-293/0) 517/0 022/0
G 35(35%) 51(51%)
    ژنوتایپینگ    
جهش
(GG)
15(15%) 22(22%) Reference -
هتروزیگوت (AG) 40(40%) 58(58%) (135/2-458/0) 989/0 977/0
طبیعی (AA`) 45(45%) 20(20%) (703/0-131/0) 303/0 006/0
 
بحث
امروزه بسیاری از پژوهش­های انجام شده نشان دهنده نقش پلی­مورفیسم­های مختلف ژن اینترلوکین 4 در ابتلا و پیشرفت بیماری مالتیپل اسکلروزیس است. به­عنوان مثال در سال 2004 مطالعه­های بروبرگ و همکاران نشان داد که تغییرهای بیان ژن اینترلوکین 4 می­تواند در مهار التهاب بیماری مالتیپل اسکلروزیس نقش داشته باشد (2). بررسی پژوهش­های انجام شده بر روی پلی­مورفیسم­های مختلف ژن اینترلوکین 4 توسطHackstein  و همکاران در سال 2001 نشان داد که انواعی از این پلی­مورفیسم ها مانند D16S407،  3093D16S و 420D16S در استعداد ابتلا به بیماری MS نقش دارند (6). هم­چنینMirel  و همکاران در سال 2002 در بررسی‌های خود بر روی افراد مبتلا به دیابت، دریافتند که ارتباط آشکاری بین پلی‌­مورفیسم ژن اینترلولین 4 (T>  C76080 ) و استعداد ابتلا به بیماری‌های خود ایمنی وجود دارد (14). در مطالعه­ای دیگرMirel  و همکاران در سال 2004 در بررسی‌های خود بر روی افراد مبتلا به MS، دریافتند که ارتباط آشکاری بین پلی‌مورفیسم ژن IL-4RG>A) 128387) و استعداد ابتلا به این بیماری وجود دارد (13). Vazquez-Tello  و همکاران در سال 2013 به بررسی پلی­مورفیسم تک­نوکلئوتیدیrs1805010 و rs1801275 در ژن اینترلوکین 4 پرداختند. آن­ها دریافتند که این پلی­مورفیسم­ها با افزایش خطر ابتلا به آسم همراه است (22). Guia  و همکاران در سال 2010 در مطالعه­های خود روی بیماران مبتلا به آسم دریافتند که ارتباط مستقیمی بین سطوح افزایش یافته IL-4 و پلی‌مورفیسم rs2243250 ژن اینترلوکین 4 وجود دارد (3). در نهایتAl-Muhsen  و همکاران در سال 2014 در مطالعه­های خود روی بیماران مبتلا به آسم درجمعیت عربستان سعودی دریافتند، پلی­مورفیسم­های rs1805010  و  rs1801275 ژن IL-4Rα استعداد ابتلا به آسم را افزایش می­‌دهد (1). اما مطالعه­ایی در زمینه پلی­مورفیسم rs1801275 ژن IL-4Rα در بیماری MS انجام نشده است لذا در ادامه مطالعه­های قبلی، تحقیق حاضر طراحی شد که نتایج آن نشان می­دهد فراوانی آللی G برای پلی­مورفیسم rs1801275 در گروه شاهد و بیمار به­صورت معناداری متفاوت است و بنابراین فراوانی آلل G می‌تواند در افزایش احتمال ابتلا به بیماری MS نقش داشته باشد (5.222χ2 و 0.22 = P-Value). علاوه­براین مطالعه­های جمعیتی انجام شده برروی پلی­مورفیسم rs1801275 نشان می­‌دهد که این پلی‌­مورفیسم دارای اطلاع دهندگی بسیار بالایی در جامعه انسانی استان اصفهان بوده و بنابراین به­نظر می­رسد ریسک فاکتوری در جهت احتمال بروز بیماری مالتیپل اسکلروزیس باشد.
نتیجه گیری
نتایج نشان داد که در بیماران مبتلا به بیماری مالتیپل اسکلروزیس فراوانی آلل G برای پلی­مورفیسم rs1801275 به­صورت معناداری افزایش می­یابد. بنابراین می­توان نتیجه گرفت که بین وجود پلی­مورفیسم rs1801275 و احتمال ابتلا به بیماری مالتیپل اسکلروزیس ارتباط معناداری وجود دارد.
سپاسگزاری
این مقاله برگرفته از پایان نامه کارشناسی ارشد و تحت حمایت معاونت پژوهشی دانشگاه آزاد شهرکرد (کد: 13330503952025) است. بدین­وسیله نویسندگان از تمام افرادی که در جمع آوری نمونه­های خون در این پژوهش یاری رساندند کمال تشکر و قدردانی را می­نمایند.

منابع
1. Al-Muhsen S, Vazquez-Tello A, Alzaabi A, Al-Hajjaj MS, Al-Jahdali HH, Halwani R. IL-4 receptor alpha single-nucleotide polymorphisms rs1805010 and rs1801275 are associated with increased risk of asthma in a Saudi Arabian population. Annals of thoracic medicine. 2014;9(2):81.
2. Broberg EK, Salmi AA, Hukkanen V. IL-4 is the key regulator in herpes simplex virus-based gene therapy of BALB/c experimental autoimmune encephalomyelitis. Neuroscience letters. 2004;364(3):173-8.
3. de Guia RM, Ramos JD. The-590C/T IL4 single-nucleotide polymorphism as a genetic factor of atopic allergy. Int J MolEpidemiol Genet. 2010; 1(1):67-73.
4. Etemadifar M, Abtahi SH. Multiple Sclerosis in Isfahan: past, present and future. International journal of preventive medicine. 2012; 3(5): 12-18.
5.Gourraud PA, Harbo HF, Hauser SL, Baranzini SE. The genetics of multiple sclerosis: an uptodate review. Immunological reviews. 2012; 248(1):87-103.
6.Hackstein H, Bitsch A, Bohnert A, Hofmann H, Weber F, Ohly A, Linington C, Mäurer M, Poser S, Rieckmann P, Bein G. Analysis of interleukin-4 receptor α chain variants in multiple sclerosis. Journal of neuroimmunology. 2001; 113(2):240-8.
7. Kalman B, Albert RH, Leist TP. Genetics of multiple sclerosis: determinants of autoimmunity and neurodegeneration. Autoimmunity. 2002; 35(4):225-34.
8. Kantarci O, Wingerchuk D. Epidemiology and natural history of multiple sclerosis: new insights. Current opinion in neurology. 2006; 19(3):248-54.
9. Kruse S, Braun S, Deichmann KA. Distinct signal transduction processes by IL-4 and IL-13 and influences from the Q551R variant of the human IL-4 receptor alpha chain. Respiratory research. 2002; 3(1):1.
10. Lassmann H. What drives disease in multiple sclerosis: inflammation or neurodegeneration? Clinical and Experimental Neuroimmunology. 2010; 1(1):2-11.
11. McFarland HF, Martin R. Multiple sclerosis: a complicated picture of autoimmunity. Nature immunology. 2007;8(9):913-9.
12. Minderhoud JM, Hoeven JH, Prange AJ. Course and prognosis of chronic progressive multiple sclerosis: results of an epidemiological study. Actaneurologicascandinavica. 1988;78(1):10-5.
13. Mirel DB, Barcellos LF, Wang J, Hauser SL, Oksenberg JR, Erlich HA. Analysis of IL4R haplotypes in predisposition to multiple sclerosis. Genes and immunity. 2004; 5(2):138-41.
14. Mirel DB, Valdes AM, Lazzeroni LC, Reynolds RL, Erlich HA, Noble JA. Association of IL4R haplotypes with type 1 diabetes. Diabetes. 2002; 51(11):3336-41.
15. Oksenberg JR, Baranzini SE, Sawcer S, Hauser SL. The genetics of multiple sclerosis: SNPs to pathways to pathogenesis. Nature Reviews Genetics. 2008;9(7):516-26.
16. Pandit L, Ban M, Sawcer S, Singhal B, Nair S, Radhakrishnan K, Shetty R, Misri Z, Hegde S, Bhat IG. Evaluation of the established non-MHC multiple sclerosis loci in an Indian population. Multiple Sclerosis Journal. 2011; 17(2):139-43.
17. Ramagopalan SV, Dobson R, Meier UC, Giovannoni G. Multiple sclerosis: risk factors, prodromes, and potential causal pathways. The Lancet Neurology. 2010;9(7):727-39.
18. Sawcer S, Jones HB, Feakes R, Gray J, Smaldon N, Chataway J, Robertson N, Clayton D, Goodfellow PN, Compston A. A genome screen in multiple sclerosis reveals susceptibility loci on chromosome 6p21 and 17q22. Nature genetics. 1996; 13(4):464-8.
19. Serra C, Mameli G, Arru G, Sotgiu S, Rosati G, Dolei A. In vitro modulation of the multiple sclerosis (MS)-associated retrovirus by cytokines: implications for MS pathogenesis. Journal of neurovirology. 2003; 9(6):637-43.
20. Sospedra M, Martin R. Immunology of multiple sclerosis. Annu. Rev. Immunol. 2005; 23:683-747.
21. Tabor HK, Risch NJ, Myers RM. Candidate-gene approaches for studying complex genetic traits: practical considerations. Nature Reviews Genetics. 2002;3(5):391-7.
22. Vazquez-Tello A, Halwani R, Jamhawi A, Al-Dosari MS, Al-Muhsen S. Il-4 receptor alpha single nucleotide polymorphisms rs1805010 and rs1801275 are associated with increased risk of asthma in a Saudi Arabian population. Allergy: European Journal of Allergy and Clinical Immunology. 2013;68:691.
23. Watson CT, Disanto G, Breden F, Giovannoni G, Ramagopalan SV. Estimating the proportion of variation in susceptibility to multiple sclerosis captured by common SNPs. Scientific reports. 2012; 2:770.
 
 
 
[1] - Multiple Sclerosis
[2] - Multiple sclerosis international federation
[3]- Central Nerve System
[4]- Antigen Presenting Cell
[5]- Blood Brain Barrier
[6] - Relapsing Remitting multiple sclerosis
[7] - Primary Progressive multiple sclerosis
[8] - Secondary Progressive multiple sclerosis
[9] - Relapsing Progressive Multiple Sclerosis
[10] - High resolution melting
[11] -Polymorphism information content
نوع مطالعه: مقاله تحقیقی | موضوع مقاله: سلولی و مولکولی
دریافت: 1397/12/26 | پذیرش: 1397/12/26 | انتشار: 1397/12/26

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

کلیه حقوق این وب سایت متعلق به مجله تازه های بیوتکنولوژی سلولی - مولکولی می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2021 CC BY-NC 4.0 | New Cellular and Molecular Biotechnology Journal

Designed & Developed by : Yektaweb