دوره 10، شماره 38 - ( 1-1399 )                   جلد 10 شماره 38 صفحات 68-61 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Ziauddini A H, Gholami-Ahangaran M, Ahmadi-Dastgerd A I. Detection of virulence genes of intimin, hemolysin and shigatoxin in Escherichia coli isolated from Pscittacin. NCMBJ. 2020; 10 (38) :61-68
URL: http://ncmbjpiau.ir/article-1-1278-fa.html
ضیاء الدینی امیرحسین، غلامی آهنگران مجید، احمدی دستگردی آسیه. ردیابی ژن های حدت اینتیمین، همولیزین و شیگاتوکسین در اشریشیاکلی جدا شده از طوطی‌سانان. مجله تازه هاي بيوتكنولوژي سلولي و مولكولي. 1399; 10 (38) :68-61

URL: http://ncmbjpiau.ir/article-1-1278-fa.html


گروه علوم و صنایع غذایی، واحد اردستان، دانشگاه آزاد اسلامی، اردستان، ایران.
متن کامل [PDF 3345 kb]   (933 دریافت)     |   چکیده (HTML)  (2187 مشاهده)
متن کامل:   (288 مشاهده)

ردیابی ژن­های حدت اینتیمین، همولیزین و شیگاتوکسین در

 اشریشیاکلی جدا شده از طوطی­سانان

امیرحسین ضیاء الدینی1، مجید غلامی آهنگران2*، آسیه احمدی دستگردی3

1. دانشکده دامپزشکی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران.

2. گروه علوم درمانگاهی، دانشکده دامپزشکی، واحد شهرکرد، دانشگاه آزاد اسلامی، شهرکرد، ایران.

3. گروه علوم و صنایع غذایی، واحد اردستان، دانشگاه آزاد اسلامی، اردستان، ایران.


چکیده

سابقه و هدف: اشریشیاکلی یک عامل عفونی مشترک بین انسان و حیوانات است که دارای ژن­های حدت زیادی است. یکی از ژن­های حدت واجد اهمیت اینتیمین است که عامل اتصال باکتری به سلول­های مخاطی است. از طرفی ژن­های حدت همولیزین و شیگاتوکسین نیز با تولید سم باکتریایی عامل ایجاد عوارض گوارشی هستند. لذا سویه­های اشریشیاکلی که واجد ژن­های حدت مذکور باشند می­توانند در انسان ایجاد بیماری کنند. در این راستا، در مطالعه اخیر به ردیابی ژن­های حدت مذکور در سویه­های اشریشیاکلی جدا شده از طوطی­سانان پرداخته شد.

مواد و روش­ها: به­منظور شناسایی ژن­های حدت در اشریشیاکلی با منشاء طوطی­سانان، 100 نمونه سوآب از ناحیه کلواک انواع طوطی­سانان از کلنی‌های نگهداری طوطی در استان اصفهان و چهارمحال و بختیاری جمع­آوری شد. پس از کشت و خالص­سازی، با تست­های بیوشیمیایی به تأیید موارد آلودگی اشریشیاکلی پرداخته شد. سپس با استخراج DNA به­روش جوشاندن به ردیابی ژن­های همولیزین، اینتیمین و زیررده­های 1 و 2 شیگاتوکسین ( stx1و stx2 ) پرداخته شد.

یافته­ها: نتایج نشان داد 57/18 درصد از جدایه‌های اشریشیاکلی جدا شده واجد ژن اینتیمین ، 28/4 درصد واجد ژن stx2  و 85/2% واجد همولیزین بودند. تنها یک جدایه واجد ژن‌های اینتیمین و همولیزین وstx2  به طور همزمان  بود (%42/1). در هیچ‌یک از جدایه‌ها ژن stx1 ردیابی نشد.

نتیجه­گیری: با توجه به افزایش تقاضا برای نگه­داری انواع طوطی‌سانان به­عنوان حیوان دست‌آموز برای کودکان و نوجوانان لازم است مراقبت­های بیش­تری در جهت کاهش خطر انتقال بیماری‌های مشترک از این پرندگان به انسان صورت بگیرد.

واژه­های کلیدی: شیگاتوکسین، اینتیمین، همولیزین، اشریشیاکلی، طوطی­سانان.


 

مقدمه

اشریشیاکلی عامل مهم اسهال در کشورهای در حال توسعه است. عامل بیماری به طور گسترده در روده حیوانات وجود دارد و اکثر عفونت­های انسانی در نتیحه مصرف غذای خام یا نیم­پز ایجاد می­شود. گزارشاتی مبنی­بر آلودگی گوشت حیوانات و طیور وجود دارد (1). به­نظر می­رسد این باکتری در روده حیوانات به­دلیل ساختار گیرنده­های گوارشی قادر به بیماری­زایی نیست. اما در انسان در صورت وجود ژن عامل اتصال ایجاد بیماری می‌کند. هم­چنین به­نظر می‌رسد که این باکتری با اتصال به سلول­های گوارشی و تولید شیگاتوکسین­ها می­تواند بیماری­زایی خود را در انسان ایجاد کند (2). در خصوص خطر احتمال انتقال عوامل عفونی زئونوز از طوطی­سانان اطلاعات کمی وجود دارد. عمده‌ عوارض ناشی از اشریشیاکلی بیماری­زا در طیور به­شکل التهاب کیسه‌ هوایی و سپتی سمی است. درباره بیماری­زایی اشریشیاکلی به­صورت انتریت در پرندگان اطلاعات زیادی در دست نیست. اما سویه‌های واجد ژن‌های حدت که بتوانند برای دستگاه گوارش بیماری­زا باشند از نظر بهداشت عمومی در انسان بسیار مهم است (3). اشریشیاکلی مولد شیگاتوکسین و اشریشیاکلیانتروپاتوژن از انواع پاتوتیپ بیماری­زای گوارشی هستند که می‌تواند منجر به عوارض گوارشی در انسان شود و به­عنوان پاتوژن زئونوز بررسی می‌شود.  اشریشیاکلی انتروپاتوژن با چسبیدن و اثرگذاری بر مخاط پوششی روده‌ها منجر به اسهال می‌گردد. این نوع اشریشیاکلی واجد ژن اینتیمین (eae) و پلاسمید EAF هستند. اما  اشریشیاکلی مولد شیگاتوکسین علاوه­بر این­که واجد ژن‌های اتصال و اثرگذاری هستند قادر به تولید شیگاتوکسین هستند که به­عنوان یک فاکتور حدت بسیار مهم در اشریشیاکلی مولد اسهال نقش دارند (4). ژن شیگاتوکسین واجد دو زیر واحد 1 و 2 (stx1 و stx2) است که محصول این زیررده­های ژنومی قادر به مهار سنتز پروتئین در سلول هستند و در نهایت منجر به مرگ سلول می‌گردد. شیگاتوکسین 2 بسیار سمی‌تر از شیگاتوکسین 1 است و اغلب با ایجاد سندرم همولیتیک اورمیک مرتبط است (4). در بین حیوانات، نشخوارکنندگان به­عنوان مخزن اصلی اشریشیاکلی مولد شیگاتوکسین هستند، اما سایر حیوانات مانند سگ، گربه و خوک نیز می‌توانند ناقل اشریشیاکلی مولد شیگاتوکسین و اشریشیاکلی انتروپاتوژن باشند (5). علاوه­بر آن در برخی مطالعه­ها سویه‌ای مولد شیگاتوکسین از پرندگان وحشی و حتی طیور اهلی نیز در مناطق مختلف جغرافیایی جدا شده است.

  Silva همکاران در سال 2009 به­بررسی سویه‌های اشریشیاکلی در مدفوع تازه کبوتران پرداختند. نتایج نشان داد 12% نمونه‌های دریافتی قادر به تولید شیگاتوکسین بودند (6). در مطالعه دیگریSchmidt  و همکاران واریانت دیگری از شیگاتوکسین2 تحت نام stx2f را در مدفوع کبوتر شناسایی کردند. شیوع این واریانت در سویه‌های اشریشیاکلی مدفوع کبوتر 5/12% گزارش شد (7). Kobayashi و همکاران در سال 2009 به­بررسی خصوصیت­های سویه‌های واجد ژن‌های اینتیمین و شیگاتوکسین در پرنده‌های وحشی ژاپن پرداختند و نشان دادند شیوع سویه‌های واجد ژن اینتیمین و شیگاتوکسین به­ترتیب 25% و 5% است. در این بررسی بیان شده است که پرندگان می­توانند به­عنوان مخزن و ناقل اشریشیاکلی انتروپاتوژن مطرح باشند (4). Nielsen و همکاران به­بررسی اشریشیاکلی تولیدکننده شیگاتوکسین در حیوانات وحشی که در تماس نزدیک با گله‌های خوک و گاو بودند، پرداختند. این بررسی نشان داد موش و پرندگان به­عنوان ناقل اشریشیاکلی تولیدکننده شیگاتوکسین مطرح هستند (8). در یک بررسی از 97 سویه اشریشیاکلی پاتوژن طیور، 52 جدایه از ضایعات سلولیت، سپتی سمی و سندرم تورم سر و 5 جدایه مدفوعی از ماکیان سالم، واجد توالی ژن شیگاتوکسین بودند. اکثریت این جدایه‌ها واجد ژن stx1 و فقط 3 نمونه واجد stx2 بودند. به­نظر می­رسد طیور به­ویژه کبوتر در برخی مناطق خاص جغرافیائی به­عنوان منبع طبیعی اشریشیاکلی تولیدکننده شیگاتوکسین عمل می‌کند، به­طوری­که کبوترها در کلرادو، ماکیان و کبوتر در هند و ماکیان و کبوتر در فنلاند منبع اشریشیاکلی تولیدکننده شیگاتوکسین نبودند (2). در یک بررسی دیگر Foster و همکاران مدفوع پرندکان وحشی را در جنوب شرق اسکاتلند از لحاظ وجود اشریشیاکلی O157H7 مورد بررسی قرار دادند و تنها یک مورد را از لحاظ وجود اشریشیاکلی O157H7 مثبت گزارش کردند (5).

براساس اطلاعات موجود تا به­حال به­بررسی خصوصیت­های انتروتوکسوژنیک اشریشیاکلی جدا شده از مدفوع طوطی­سانان پرداخته نشده است. در همین راستا هدف از مطالعه اخیر شناسایی این باکتری در مدفوع طوطی­سانان از طریق شناسایی سیتوتوکسین­های عامل بیماری­زای روده­ای (شیگاتوکسین 1 و 2) در کنار عامل اتصال باکتری به انتروسیت (اینتیمین) و شناسایی ژن عامل چسبیدن باکتری به سلول­های گوارشی و ژن تولیدکننده سیتوتوکسین است.

مواد و روش­ها

نمونه­گیری

این مطالعه در بهار 1397 به­مدت 3 ماه انجام شد. 100 نمونه سوآب از ناحیه کلواک انواع طوطی­سانان (کاسکو، مرغ عشق، لاوبرد، ماکائو، پاروت، عروس هلندی، کوکاتو و کونور) از کلنی‌های نگهداری طوطی در اصفهان و چهارمحال و بختیاری جمع­آوری ‌شد و در لوله آزمایش استریل درب­دار به آزمایشگاه منتقل گردید.

شناسایی اشریشیاکلی

 

به­منظور شناسایی باکتری اشریشیاکلی، نمونه­های جمع­آوری شده، بر روی محیط مک­کانگی کشت داده شد و برای 24 ساعت در 37 درجه سانتی­گراد انکوبه شد. در صورت رویت شدن پرگنه‌های لاکتوز مثبت (صورتی رنگ)، از پرگنه‌های مذکور بر روی محیط EMB به­صورت خطی کشت داده شد و به­مدت 24 ساعت در دمای 37 درجه سانتی­گراد انکوبه شد. پرگنه‌های لاکتوز مثبت که بر روی محیط EMB ایجاد جلای سبز فلزی نمودند به­صورت اولیه به­عنوان باکتری اشریشیاکلی شناسایی گردیدند. سپس بر روی این پرگنه‌ها تست­های افتراقی IMVIC انجام شد. در صورتی که از لحاظ تست­های بیوشیمیایی تولید ایندول، احیای متیل رد، واکنش Voges-proskawer و احیای سیترات به­ترتیب به­صورت مثبت، مثبت، منفی، منفی بودند به­عنوان اشریشیاکلی شناسایی شدند.

استخراج DNA

 برای استخراج DNA از روش جوشاندن استفاده شد (9). از کشت 24 ساعته باکتری در محیط BHI به­عنوان منبع DNA استفاد شد.

آزمون PCR

برای انجام PCR از دستگاه Master cycler gradiant (Eppendorf, Germany) استفاده شد. PCR در حجم 50 میکرولیتر شامل یک، میکرولیتر DNA تخلیص شده (حدود 50 نانو گرم)، 10 میلی­مول تریس هیدروکلریدریک (اسیدیته 4/8)، 10 میلی­مول کلرید پتاسیم، 3 میلی­مول کلرید منیزیم، 2 میلی­مول از هر کدام از پرایمرها، 2/0 میلی­مول از هرکدام  dntpها و یک واحد Taq-polymerase و مابقی تا 50 میکرولیتر آب دوبار تقطیر استریل (8/33 میکرولیتر) انجام شد. مشخصات پرایمرهای مورد استفاده در جدول 1 آمده است.

برای تعیین فاکتورهای حدت در جدایه‌های اشریشیاکلی جدا شده از زوج پرایمرهای معرفی شده توسط Fagan و همکاران (1999) استفاده شد (10،11). برنامه حرارتی برای انجام PCR شامل یک سیکل 95 درجه سانتی‌گراد به­مدت 3 دقیقه و 35 سیکل تکراری شامل واسرشت‌سازی در دمای 95 درجه سانتی‌گراد در 20 ثانیه، همسرشت‌سازی در دمای 58 درجه سانتی‌گراد به‌مدت 40 ثانیه، گسترش در دمای 72 درجه سانتی‌گراد برای 90 ثانیه و گسترش نهایی در دمای 72 درجه سانتی‌گراد به‌مدت 5 دقیقه بود. در پایان محصول PCR بر روی ژل آگارز 2 درصد به­مدت 40 دقیقه با ولتاژ 100 ولت و 400 میلی­آمپر الکتروفورز گردید.

 

 

جدول 1- اختصاصات پرایمرهای مورد استفاده

نام پرایمر

توالی پرایمر

اندازه قطعه (جفت بازی)

EHEC hly

F:ACGATGTGGTTTATTCTGGA

R:CTTCACGTGACCATACATAT

165

stx1

F: ACACTGGATGATCTCAGTGG

R: CTGAATCCCCCTCCATTATG

614

stx2

F: CCATGACAACGGACAGCAGTT

R: CCTGTCAACTGAGCAGCACTTTG

779

eaeA

F: GTGGCGAATACTGGCGAGACT

R: CCCCATTCTTTTTCACCGTCG

890

 

 

یافته­ها

از صد نمونه سواب کلواک کشت داده شده بر روی محیط مک کانکی 70 نمونه از لحاظ کشت اختصاصی و تست‌های بیوشیمیایی به­عنوان اشریشیاکلی شناسایی شدند. میزان آلودگی در هر یک از پرندگان به تفکیک در جدول 1 آمده است. در خانواده طوطی­سانان از 22 نمونه اشریشیاکلی جدا شده از مرغ عشق سه مورد از لحاظ ژن eae و یک نمونه از لحاظ هر سه ژن اینتیمین، همولیزین و شیگاتوکسین 2 مثبت بود. از هشت نمونه اشریشیاکلی جدا شده از 14 عروس هلندی یک مورد از لحاظ ژن اینتیمین مثبت شد (5/12 درصد) و از 13 سویه اشریشیاکلی جدا شده از 19 طوطی خاکستری آفریقایی (کاسکو) دو مورد واجد ژن اینتیمین و یک مورد واجد stx2 بود. در طوطی برزیلی فقط در دو سویه از 9 جدایه اشریشیاکلی جدا شده ژن اینتیمین ردیابی شد. در طوطی‌های سبز از 14 جدایه اشریشیاکلی جدا شده سه مورد دارای ژن اینتیمین و یک مورد واجد هر دو ژن stx2 و همولیزین بود. در سه جدایه اشریشیاکلی جدا شده از کونور و کوکاتو هیچ­کدام از ژن‌های حدت ردیابی نشد.

 

جدول 2- وضعیت جدایه­های مختلف اشریشیاکلی از لحاظ ژن‌های حدت مورد بررسی

گونه طوطی

تعداد قفس پرنده

تعداد جدایه اشریشیاکلی

اینتیمین

همولیزین

شیگاتوکسین 1

شیگاتوکسین 2

مرغ عشق

30

22

4

1

0

1

ماکائو

1

1

1

0

0

0

عروس هلندی

14

8

1

0

0

0

کاسکو

19

13

2

0

0

1

طوطی کوتوله برزیلی

13

9

2

0

0

0

کوکاتو

2

1

0

0

0

0

کونور

3

2

0

0

0

0

طوطی سبز

18

14

4

1

0

1

کل

100

70

13

2

0

3

درصد

100

70

57/18

85/2

0

28/4

 

 

.

 

 

شکل 1- الکتروفورز مربوط به نمونه­های مثبت ژن eae، stx2 و hly  اشریشیاکلی

 ستون یک: مارکر، ستون 2 : نمونه مثبت از نظر ژن eae با طول باند 890 جفت بازی، stx2 با طول باند 769 جفت بازی و hly با طول باند 165 جفت بازی مربوط به طوطی سبز، ستون 3 و 5: نمونه مثبت از نظر ژن eae با طول باند 890 جفت بازی، ستون 4: نمونه مثبت از نظر ژن eae با طول باند 890 جفت بازی و hly با طول باند 165 جفت بازی از مرغ عشق، ستون 6: کنترل منفی)

 

شکل 2- الکتروفورز مربوط به نمونه­های مثبت ژن eae و hly  اشریشیاکلی

ستون یک: مارکر، ستون 2 : نمونه مثبت از نظر ژن eae با طول باند 890 جفت بازی و hly با طول باند 165 جفت بازی، نمونه‌های 3 تا 5 : نمونه‌های مثبت از نظر ژن eae با طول باند 890 جفت بازی و ستون 6: کنترل منفی

شکل 3- الکتروفورز مربوط به نمونه­های مثبت ژن eae  اشریشیاکلی

ستون اول مارکر 100 جفت بازی، ستون 2 و 3 نمونه مثبت از نظر ژن eae با طول باند 890 جفت بازی

 

 

 

 

 

بحث

اشریشیاکلی مولد شیگاتوکسین و اشریشیاکلی انتروپاتوژن از انواع پاتوتیپ بیماری­زا هستند که می‌تواند منجر به عوارض گوارشی در انسان شود و به­عنوان عامل بیماری­زای مشترک بین انسان و دام مطرح هستند.  اشریشیاکلی انتروپاتوژن با چسبیدن و اثرگذاری بر مخاط پوششی روده‌ها منجر به اسهال می‌گردد. این نوع اشریشیاکلی واجد ژن اینتیمین (eae) است. اما اشریشیاکلی مولد شیگاتوکسین علاوه­بر این­که واجد ژن‌های اتصال و اثرگذاری هستند قادر به تولید شیگاتوکسین هستند که به عنوان یک فاکتور حدت بسیار مهم در اشریشیاکلی مولد اسهال نقش دارند (4). از آنجایی­که پرندگان زینتی رابطه بسیار نزدیک با صاحبان خود دارند امکان انتقال این عامل از پرندگان زینتی به انسان وجود دارد. شناسایی وضعیت سویه های مختلف اشریشیاکلی جدا شده از طوطی­سانان از نظر وجود ژن­های حدت در مراقبت های ویژه جهت کنترل این آلودگی می­تواند مؤثر واقع شود. در این راستا به ردیابی ژن­های حدت اتصال، اثرگذاری و تولید سیتوتوکسین در این پرندگان پرداخته شد.

نتایج نشان داد 57/18 درصد از جدایه‌های اشریشیاکلی واجد ژن اینتیمین و 28/4 درصد واجد ژن stx2 بودند. 85/2% واجد همولیزین و تنها یک‌جدایه واجد ژن‌های اینتیمین و همولیزین و stx2 به­طور هم­زمان بود و در هیچ‌­یک از جدایه‌ها ژن stx1 شناسایی نشد. اگرچه در مطالعه­های قبلی نیز ژن اینتیمین و شیگاتوکسین در جدایه‌های مختلف اشریشیاکلی ردیابی شده است اما فراوانی اشریشیاکلی جدا شده از طوطی­سانان حدود 11/17% گزارش شده است و فراوانی اشریشیاکلی شیگاتوکسوژنیک را در پرندگان سالم 6/4% بیان کرده­اند. در آن مطالعه، 47/8 درصد مرغ‌های عشق و 47/4 درصد پاراکیت‌ها آلودگی اشریشیاکلی مولد شیگاتوکسین را نشان دادند (12).

در مطالعه اخیر تاریخچه دقیقی از علائم گوارشی پرنده‌هایی که در آنها  اشریشیاکلی مولد شیگاتوکسین ردیابی شده است وجود ندارد و به ظاهر سالم بوده است. پیش­تر Croxen و همکاران در سال 2013 عدم وجود گیرنده‌های Globotriaosylceramid را روی سلول‌های paneth در مخاط روده، دلیل عدم حساسیت و عدم بروز علایم کلینیکی در پرندگان آلوده به اشریشیاکلی مولد شیگاتوکسین بیان نمودند (13).

اولین‌ بار بررسی آلودگی پرندگان با  اشریشیاکلی مولد شیگاتوکسین در سال 1997 مطرح شد که فراوانی اشریشیاکلی شیگاتوکسوژنیک در 6/1% پرندگان وحشی ذکر شد. این پرندگان در تماس نزدیک با فارم­های پرورشی طیور اهلی بودند که می‌توانستند با مهاجرت، امکان انتقال این جدایه را بین فارم ها فراهم کنند (7). در مطالعه اخیر امکان شناسایی منبع عفونت وجود ندارد. اما می‌توان حدس زد که نگهداری پرندگان زینتی در فروشگاه­های عرضه‌کننده پرندگان زینتی در مجاورت کبوتران اهلی و وحشی و گزارش­های مکرر از آلودگی کبوترها با اشریشیاکلی مولد شیگاتوکسین (14) می‌تواند منشاء عفونت باشد. در این مطالعه با توجه به عدم ردیابی ژن همولیزین در دو سویه از جدایه‌های اشریشیاکلی واجد ژن شیگاتوکسین،‌ به­نظر می‌رسد این دو جدایه واجد ژن شیگاتوکسین از نوع غیر O157H7 باشند. پیش­تر نیز گزارش­های زیادی منتشر شده که نشان می‌دهد اگرچه از گونه‌های مختلف پرندگان اشریشیاکلی شیگاتوکسین‌زا جدا شده است، اما در اکثر موارد سروتیپ O157H7 جدا نشده است. لذا طبق نتایج به­دست آمده از مطالعه اخیر و سایر مطالعه­ها به­نظر می‌رسد فراوانی جدایه‌های اشریشیاکلی مولد شیگاتوکسین non-O157 در مدفوع پرندگان از موارد O157H7 بیش­تر باشد. این یافته اهمیت موضوع انتقال اشریشیاکلی مولد شیگاتوکسین از طریق تماس با پرندگان را دوچندان می‌کند. چرا که ممکن است پرندگان در حالی­که هیچ‌گونه علائم بالینی نداشته باشند منبع اشریشیاکلی مولد شیگاتوکسین از نوع غیر O157H7 باشند (2). به­هرحال تصور اکثریت بر این است که اشریشیاکلی مولد شیگاتوکسین قادر به ایجاد عوارض و مشکلاتی در انسان است که عوامل حدت اینتیمین، همولیزین و شیگاتوکسین را داشته باشد که اگر چنین باشد فقط یک‌ جدایه از جدایه‌های جدا شده در مطالعه اخیر واجد هر سه ژن بوده است و سایر جدایه‌ها ممکن است برای انسان بیماری­زایی نداشته باشند.

نتیجه­گیری

از آنجایی­که پرندگان زینتی به­عنوان حیوان دست‌آموز در تماس مستقیم با صاحبان خود هستند ممکن است این پرندگان منبع اشریشیاکلی پاتوژن باشند و بتوانند باعث مشکلاتی برای صاحبان خود گردند. با توجه به شناسایی فاکتورهای حدت اینتیمین، همولیزین و زیر واحدهای شیگاتوکسین در نمونه‌های جمع‌آوری شده از انواع مختلف طوطی‌سانان در این مطالعه، لازم است به­طور ویژه برای کودکان و نوجوانان مراقبت­های بیش­تری در جهت کاهش خطر انتقال بیماری‌های مشترک از این پرندگان صورت بگیرد.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

منابع

1.Wray C, Davies RH, Corkisch JD. Enterobacteriaceae. In: Jordan FTW, Pattison M (Eds). Poultry Diseases. Cambridge: WB Saunders; 1996. p. 9-43.

2.Nolan LK, Barnes HJ, Vaillancourt JP, Abdul-Aziz T, Logue CM. Colibacillosis. In: Swayne DE, Boulianne M, Logue CM, McDougald LR, Nair V, Suarez DL (Eds). Disease of Poultry. 14th ed. Massachusetts: Wiley-Blackwell; 2020. p. 770-790.

3.Lutful Kabir SM. Avian Colibacillosis and Salmonellosis: A Closer Look at Epidemiology, Pathogenesis, Diagnosis, Control and Public Health Concerns. Int. J. Environ. Res. Pub Health 2010; 7(1): 89-114; 

4.Kobayashi H, Kanazaki M, Hata, E, Kub M. Prevalence and Characteristics of eae- and stx-Positive Strains of Escherichia coli from Wild Birds in the Immediate Environment of Tokyo Bay. J Am Soc Microbiol. 2009; 75 (1): 292-295.

5.Foster G, Evans J, Knight HI, Smith AW, Gunn GJ, Allison Lesley J. Analysis of feces samples collected from wild-bird garden feeding station in Scotland for the presence of verotoxin producing E.Coli O157H7. J Am Soc Microbiol. 2006; 72 (3): 2265-2267.

6.Silva VL, Nicoli JR, Nascimento TC, Diniz CG. Diarrheagenic Escherichia coli Strains Recovered from Urban Pigeons (Columba livia) in Brazil and Their Antimicrobial Susceptibility Patterns. J Current Microbiol. 2009; 59: 302-308.

7.Schimdt H, Scheef J, Morabito S, Carpioli A, Wieler LH, Karch HA. New Shiga Toxin 2 Variant (Stx2f) from Escherichia coli Isolated from Pigeons. J Am Soc Microbiol. 2000; 66 (3): 1205-1208.

8.Nielsen EM, Skov MN, Madsen JJ, Lodal J, Jespersen JB, Baggesen DL. Verocytotoxin-Producing Escherichia coli in Wild Birds and Rodents in Close Proximity to Farms. J Am Soc Microbiol. 2004; 70 (11): 6944-6947.

9.Oliveira CF, Paim TG, Reiter KC, Rieger A, D'Azevedo PA. Evaluation of four different DNA extraction methods in coagulase-negative staphylococci clinical isolates. Rev Inst Med Trop SP. 2014; 56(1): 29-33.

10.Fagan PK, Hornitzky MA, Bettelheim KA, Djordjevic SP. Detection of shiga-like toxin (stx1 and stx2), intimin (eaeA), and enterohemorrhagic Escherichia coli (EHEC) hemolysin (EHEC hlyA) genes in animal feces by multiplex PCR. Appl environ microbiol.  1999; 65(2): 868-72.

11.Gholami-Ahangaran, Zia-Jahromi N. Identification of shiga toxin and intimin genes in Escherichia coli detected from canary (Serinus canaria domestica). Toxicol Indust Health 2014; 30(8): 724- 727.

12.Gioia-Di Chiacchio RM, Cunha MPVR, Sturn M, Moreno LZ, Moreno AM, Pereira CBP, Martins FH, Franzolin MR, Piazza RMF, Knöbl T. Shiga toxin-producing Escherichia coli (STEC): Zoonotic risks associated with psittacine pet birds in home environments. Vet Microbiol. 29; 184: 27–30.  doi: 10.1016/j.vetmic. 2016.01.004.

13.Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB. Recent advances in understanding enteric pathogenic Escherichia coli. Clin Microbiol Rev. 2013; 26(4): 822-80.

14.Morabito S, Dell'Omo G, Agrimi U, Schmidt H, Karch H, Cheasty T, Caprioli A. Detection and characterization of Shiga toxin-producing Escherichia coli in feral pigeons. Vet Microbiol. 2001; 82(3): 275–283.

 

نوع مطالعه: مقاله پژوهشی | موضوع مقاله: سلولی و مولکولی
دریافت: 1399/2/24 | پذیرش: 1399/2/24 | انتشار: 1399/2/24

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله تازه های بیوتکنولوژی سلولی - مولکولی می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2022 CC BY-NC 4.0 | New Cellular and Molecular Biotechnology Journal

Designed & Developed by : Yektaweb