دوره 10، شماره 38 - ( 1-1399 )                   جلد 10 شماره 38 صفحات 111-99 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Siasi E, Rezaei A, Nowroozi J. Identification of 3 Virulence Factors kpsMTII, iucD‚ usp in Urinary Tract Infection E. coli by Multiplex-PCR. NCMBJ. 2020; 10 (38) :99-111
URL: http://ncmbjpiau.ir/article-1-1279-fa.html
سیاسی الهام، رضایی عاطفه، نوروزی جمیله. شناسایی همزمان 3 فاکتور ویرولانس kpsMTII، iucD و usp در اشریشیا کلی ایجاد کننده عفونت دستگاه ادراری با روش Multiplex-PCR. مجله تازه هاي بيوتكنولوژي سلولي و مولكولي. 1399; 10 (38) :111-99

URL: http://ncmbjpiau.ir/article-1-1279-fa.html


گروه میکروبیولوژی، دانشکده علوم زیستی، دانشگاه آزاد اسلامی، واحد تهران شمال، تهران، ایران
متن کامل [PDF 4871 kb]   (851 دریافت)     |   چکیده (HTML)  (2034 مشاهده)
متن کامل:   (306 مشاهده)

شناسایی هم­زمان 3 فاکتور ویرولانس kpsMTII، iucD و usp در

 اشریشیاکلی ایجاد کننده عفونت دستگاه ادراری با روش

 Multiplex-PCR

الهام سیاسی *، عاطفه رضایی، جمیله نوروزی

گروه میکروبیولوژی، دانشکده علوم زیستی، دانشگاه آزاد اسلامی، واحد تهران شمال، تهران، ایران.


چکیده

سابقه و هدف: باکتری اشریشیاکلی (E. coli) فلور طبیعی در روده طبیعی انسان و حیوانات است. این باکتری یکی از عوامل اصلی عفونت ادراری است. هدف از این مطالعه شناسایی و بررسی حضور هم­زمان 3 فاکتور بیماری­زای kpsMTII، iucD  و usp در ژنوم سویه­های باکتری اشریشیاکلی ایجاد کننده عفونت ادراری بود.

مواد و روش­ها: 60 نمونه باکتری اشریشیاکلی ایجاد کننده عفونت ادراری جمع­آوری گردید. باکتری­های مورد نظر با تست­های بیوشیمیایی و رنگ­آمیزی گرم شناسایی شدند. ژنوم باکتری از طریق کیت­های جداسازی DNA باکتری گرم منفی جداسازی شد. سپس برای حضور هم­زمان 3 عامل بیماری­زایی مورد نظر از روش Multiplex-PCR استفاده شد.

یافته­ها: در این 60 نمونه باکتری اشریشیاکلی جداسازی شده، حضور ژن­های بیماری­زا، kpsMTII 66/71 درصد، iucD 33/88 درصد، usp 66/36 درصد بود و هم­چنین حضور هم­زمان 3 فاکتور در 33/28 درصد نمونه­ها مشاهده شد. بین فراوانی حضور این سه ژن با ایجاد عفونت ادراری در نمونه­های اشریشیاکلی مورد بررسی ارتباط معنی­داری وجود داشت (05/0 Pvalue< ).

نتیجه­گیری: بر اساس نتایج این تحقیق، مشابه با مطالعه­های پیشین، بین حضور این سه ژن بیماری زا در نمونه­های مورد مطالعه از باکتری اشریشیاکلی ایجاد کننده عفونت ادراری می­تواند ارتباط معنی­دار وجود داشته باشد.

واژه­های کلیدی: اشریشیاکلی، عفونت ادراری، ژن­های بیماری­زا، Multiplex PCR.


 

مقدمه

باکتری اشریشیاکلی (E. coli نوعی باسیل گرم منفی از خانواده انتروباکتریاسه است.‌ باکتری اشریشیاکلی به­صورت طبیعی و هم­زیست در دستگاه گوارش انسان و حیوانات زندگی می­کند (1). انواع گونه­های مختلف این باکتری موجب بروز بیماری در انسان و حیوانات از طریق ایجاد عفونت یا ترشح سموم می­شوند. کودکان، افراد مسن و افرادی که به بیماری­های مزمن مبتلا هستند، نسبت­به عفونت ناشی از این باکتری حساس­تر بوده و علائم عفونت با شدت بیش­تری در آن­ها بروز می­کند (2). گاهی باکتری اشریشیاکلی از دستگاه گوارش انسان، تغییر مکان می­دهد و به دستگاه ادراری و مجاری ادراری وارد می­شود، باعث ایجاد عفونت ادراری می­شود (3). عفونت دستگاه ادراری یک عفونت باکتریایی است که دستگاه ادراری را تحت تأثیر قرار می­دهد. باکتری اشریشیاکلی مهم­ترین عامل عفونت ادراری است (4). عفونت ادراری در میان خانم­ها به­دلیل آناتومی خاص دستگاه ادراری، بسیار شایع­تر از آقایان است و عود عفونت بسیار معمول است. شدت عفونت بستگی­به باکتری عامل عفونت ) مرتبط با فاکتورهای بیماری­زای آن) و حساسیت میزبان دارد (5، 6). سویه­های باکتری اشریشیاکلی انواع مختلفی از عوامل بیماری­زایی از جمله سیستم چسبندگی (چسبنده­ها)، توکسین­ها، سیستم­های اکتساب آهن، آلفا همولیزین، فاکتور نکروزدهنده سایتوتوکسیک را دارا هستند. این عوامل می­توانند به ترویج ویرولانس و بیماری­زایی باکتری اشریشیاکلی کمک کنند. از سیستم چسبندگی یا همان ادهسین­ها می­توان به فیمبریه تیپ 1 اشاره کرد. از سیستم­های اکتساب آهن سیدروفورها هستند. سیدروفورها به دو گروه، انتروباکتین و آئروباکتین تقسیم می­شوند. هم­چنین به تولید توکسین­هایی مانند آلفا همولیزین و سایتوتوکسیک نکروزدهنده می­توان اشاره کرد (9 - 7).  کپسول باکتری اشریشیاکلی در بیماری­زایی باکتری نفش دارد. کپسول باکتری باعث چسبیدن باکتری و اتصال باکتری به بافت سلول میزبان می­شود (10). فاکتور kpsMTII کپسول باکتری است، که مقاومت باکتری را در برابر آنتی­بیوتیک ها زیاد می­کند (11). کپسول باعث چسبیدن باکتری و اتصال باکتری به سلول میزبان می­شود و هم­چنین باعث مقاومت باکتری در برابر استرس­ها محیطی می­شود. پس این عامل در ایجاد عفونت و کلونیزاسیون باکتری نقش دارد (12). از دیگر خصوصیت­های باکتری اشریشیاکلی برای ایجاد عفونت ادراری سیستم اکتساب آهن است که باکتری با کمک سیدروفورها آهن را جذب می­کند (13). فاکتور iucD  سیدروفور یا آهن بر است که از دسته آئروباکتین­ها است. آهن را از محیط­های فقیر مانند مجاری ادراری جذب می­کند و در اختیار باکتری قرار می­ دهد. این مکانیسم نوعی مکانیسم دفاعی برای باکتری محسوب می­شود. عامل iucD در گروه B2، از گروه­های ژن­های بیماری­زایی قرار دارد. این عامل در کلونیزاسیون باکتری نقش دارد (12، 13). عامل usp همان ژن کد کننده Uropathogenic Specific Protein است. یک نوع پروتئین اختصاصی بیماری­زایی باکتری اشریشیاکلی است. عامل usp در شدت بیماری­زایی و عفونت باکتری نقش دارد. گاهی اوقات عفونت ادراری همراه با پروتئینوری است. عامل usp عامل ایجاد پروتئینوری است  (12،13). باکتری اشریشیاکلی که عامل عفونت مجاری ادراری و بخش عمده­ای از عفونت ادراری بیمارستانی محسوب می­شود به این 3 عامل بیماری­زا kpsMTII, iucD, usp برای کلونیزاسیون و شدت بیماری­زایی نیاز دارد. بنابراین این مطالعه به شناسایی و حضور هم­زمان این 3 عامل بیماری­زا در نمونه­های اشریشیاکلی ایجاد کننده عفونت ادراری، که می­تواند در شدت و گسترش این بیماری مؤثر باشد، پرداخته است.

مواد و روش­ها

جمع­آوری نمونه - نمونه‌گیری و جمع‌آوری نمونه‌های ادراری، از شهر تهران طی 5 ماه در تابستان و پائیز 1397 از دو آزمایشگاه تشخیص طبی ایرانا و اکسیر انجام‌ شد. نمونه­ها از افراد دارای عفونت ادراری که به تشخیص پزشک و مسئول ازمایشگاه دارای علائم عفونت ادراری بودند تهیه شد و پس از شناسایی باکتری ایجاد کننده عفونت ادراری در نمونه ­های مورد بررسی، 60 نمونه که ‌با باکتری اشریشیاکلی آلوده بودند، جداسازی شدند.

جداسازی و شناسایی ایزوله­های اشریشیاکلی از نمونه­های ادرار -  جهت تأیید آلوده بودن نمونه­های افراد مبتلا به عفونت ادراری به اشریشیاکلی نمونه­های ادرار بر روی محیط کشت بلاد آگار(Blood Agar) (شرکت مرک المان) و ائوزین متیلن­بلو EMB (Eosin Methylene Blue Agar) (شرکت مرک آلمان) کشت داده شدند و به­مدت 24 ساعت در 37 درجه سانتی­گراد انکوبه شدند. پس از کشت ادرار، رنگ‌آمیزی ‌گرم برای تفکیک باکتری­های گرم منفی از باکتری­های گرم مثبت و جداسازی ‌نمونه باکتری گرم منفی موردنظر استفاده شد. سپس برای شناسایی باکتری اشریشیاکلی از سایر باکتری­های گرم منفی کشت در محیط­های کشت افتراقی (شرکت مرک آلمان) شامل: اندول، مک کانکی، ائوزین متیلین بلو، سیمون سیترات، اوره از، MR-VP، SIM، TSI، تخمیر قند، اسکولین براث و تست ­ی اکسیداز و کاتالاز استفاده شد. محیط­های کشت برای ایجاد کلنی باکتری­ها به­مدت 24 ساعت در دمای 37 درجه سانتی­گراد انکوبه شدند و سپس نتایج بررسی شد.

شناسایی ژن­های ویرولانس kpsMTII، iucD و usp در ایزوله­های  اشریشیاکلی با استفاده از تکنیک Multiplex PCR

استخراج DNA باکتری - استخراج ژنوم نمونه­های باکتری اشریشیاکلی با استفاده از کیت­های استخراج DNA باکتری گرم منفی (شرکت سینا کلون با نام CinnaPur-DNA CAT NO: PR881612)  انجام شد. کیفیت و کمیت DNA استخراج شده با الکتروفورز بر روی آگارز و استفاده از دستگاه نانودراپ کنترل گردید. به این ترتیب که 3 میکرولیتر از DNA بر روی ژل آگارز الکتروفورز شد. هم­چنین به­منظور آگاهی از غلظت DNA و درجه خلوص آن، 1 میکرولیتر از DNA استخراج شده در دستگاه نانودراپ قرار داده شد و نسبت جذب نوری آن در طول موج­های 260 به 280 خوانده شد.

واکنش Multiplex PCR - پس از استخراج DNA از نمونه­های باکتری­های شناسایی شده برای بررسی حضور هم­زمان ژن­های kpsMTII، iucD  و usp از روش Multiplex-PCR استفاده شد. در این تکنیک از 3 جفت پرایمر اختصاصی در یک محلول PCR برای تکثیر 3 توالی هدف (3 ژن kpsMTII، iucD و usp ) به­طور هم­زمان استفاده شد. زیرا در Multiplex-PCR یا PCR چندتایی چندین جفت پرایمر هم­زمان مورد نیاز است. پرایمرها ( تهیه شده از شرکت تکاپوزیست) و مواد (تهیه شده از شرکت ویرا ژن) و برنامه مورد نیاز برای دستگاه PCR که در این مطالعه مورد استفاده قرار گرفته­اند به­ترتیب در جداول 1و 2 و 3 اورده شده اند. پس از انجام واکنش PCR  برای بررسی تشکیل باندهای مربوط­به این 3 عامل بیماری­زا kpsMTII، iucD و usp محصول­های PCR بر روی ژل اگاروز الکتروفورز شدند و از نمونه فاقد DNA (دارای آب مقطر) به­عنوان کنترل منفی و برای کنترل مثبت از سویه استاندارد E. coli ATC25923، در کنار چاهک­های نمونه­های مورد آزمون استفاده شد. سپس رنگ­امیزی با رنگ اتیدیوم برامید و عکس­برداری با دستگاه ژل­داک انجام گرفت.

آنالیز آماری- برای تجزیه تحلیل درصد حضور 3 فاکتور بیمار­زا در 60 نمونه باکتری جداسازی شده آنالیز آماری با نرم­افزار SPSS ورژن 24 (تست کای اسکوئر) انجام شد و میزان 05/0<  Pvalue معنی­دار در نظر گرفته شد.

 

 

 

 

 

جدول 1- پرایمرهای مورد استفاده در این پژوهش

رفرنس مورد استفاده

طول محصول PCR

توالی پرایمر  5'-3'

نام ژن

12

 602  bp       

F- TACCGGATTGTCATATGCAGACCGT

R-AATATCTTCCTCCAGTCCGGAGAAG

iucD

12

1000  bp

F- ATGCTACTGTTTCCGGGTAGTGTGT

R- CATCATGTAGTCGGGGCGTAACAAT

usP

12

272  bp

F- GCGCATTTGCTGATACTGTTG

R- CATCAGACGATAAGCATGAGCA

kpsMTII

جدول 2- مقادیر مورد استفاده جهت واکنش Multiplex-PCR در حجم نهایی   lμ20

مواد برای واکنش PCR

مقدار برحسب میکرولیتر (lμ )

Master mix 2X

5

DNA  نمونه (100 نانوگرم)

4

پرایمر چپ (10 پیکومول)

3

پرایمر راست (10 پیکومول)

3

اب مقطر

5

مواد موجود در Master mix

مقدار برحسب میکرولیتر (lμ )

Taq polymerase

5/0

dNTP (µM 200)

1

بافر

5/2

MgCl2 (mM 1)

1

 

 

 

جدول 3- برنامه تنظیم درجه حرارت و زمان برای انجام مراحل واکنش Multiplex-PCR

شماره مرحله

نام مرحله

دما (درجه سانتی­گراد)

زمان

1

واسرشت شدن اولیه

95

3 دقیقه

2

واشرست شدن

95

30 ثانیه

3

دمای اتصال

55

30 ثانیه

4

طویل شدن

72

40 ثانیه

5

طویل شدن انتهایی

72

10 دقیقه

* مراحل 2 تا 4 در 35 سیکل تکرارشدند.

 

 

یافته­ها

بررسی توزیع فراوانی اشریشیاکلی در جمعیت مورد مطالعه نمونه­های جداسازی شده مربوط به 4 مرد زیر 40 سال، 5 مرد بالای 40 سال، 17 زن زیر 30 سال، 22 زن 30 تا 50 ساله، 12 زن بالای 50 سال بود. در مجموع نمونه­های اشریشیاکلی از عفونت ادراری در 9 مرد (15%) و 51 زن (85%) شناسایی شد (نمودار 1 و2).

نتایج شناسایی ایزوله­های اشریشیاکلی از نمونه­های ادرار با کشت و تست­های بیوشیمیایی-  با نتایج حاصل از رنگ­آمیزی گرم، کشت و تست­های افتراقی حضور باکتری گرم منفی اشریشیاکلی در 60 نمونه از نمونه­های عفونت ادراری تأیید شد.

نتایج مشاهده باندهای محصول­های PCR بر روی ژل الکتروفورز- باندهای مربوط به حضور هر یک از ژن­های kpsMTII، iucD  و  uspبهترتیب با طول bp 272، bp 602 و bp 1000 در کنار مارکر مولکولی با سایز bp 100 و نمونه­های کنترل مثبت و کنترل منفی در شکل 1 آورده شده است.

 

 

نمودار 1- تفکیک جنسی و سنی نمونه­های مورد بررسی در این پژوهش

 

نمودار 2- درصد نمونه­ های مورد بررسی بر اساس جنسیت


 

 

 

 

 

 

 

 

 

 

 

11  10    9     8   7     6    5     4    3    2   1 

 

 

مارکر مولکولی با سایز  bp 100

 

 

شکل 1 نتایج Multiplex PCR برای هر یک از ژن­های kpsMTII، iucD  و  usp.

خانه شماره 1: مارکر مولکولی (bp100) ؛ خانه شماره 2: کنترل مثبت سویه استاندارد E. coli ATC25923 ؛ خانه شماره 3 : کنترل منفی آب مقطر؛ خانه­های شماره 4 و6 : نمونه­های دارای حضور 2 ژن iucD (bp602) ، kpsMTII (bp272)، خانه­های شماره 5 و 7 و 9 : نمونه­های دارای حضور 3 ژن  usp (bp1000) ، iucD (bp602kpsMTII (bp272)، خانه شماره : نمونه دارای حضور 2 ژن usp (bp1000) ، kpsMTII (bp272)، خانه­های شماره 10 و 11 : نمونه­های دارای حضور ژن iucD (bp602).

 

جدول 4- درصد فراوانی حضور هر یک از 3 ژن و Pvalue ی ان در 60 نمونه مورد مطالعه

Pvalue

بین فراوانی حضور 3 ژن

حضور هم­زمان 3 ژن

درصد فراوانی هر ژن

حضور هر ژن

نام ژن

 

 

71.7

43

kpsMTII

P= 0.00

33/28

88.3

53

iucD

 

 

36.7

22

usp

 

نمودار 3- درصد فراوانی حضور ژن­های kpsMTII، iucD  و usp در نمونه­های مورد مطالعه  به تفکیک جنس افراد

 

نتیجه تجزیه و تحلیل داده­ها - درصد فراوانی ژن­های kpsMTII، iucD و usp و ارتباط حضور سه ژن در 60 نمونه باکتری­های مورد مطالعه در جدول 4 و نمودار 3 آورده شده است. 

 با توجه به جداول آنالیز آماری مربوطه، چنین نتیجه می­شود که بین فراوانی حضور سه ژن kpsMTII، iucD  و usp در 60 نمونه باکتری اشریشیاکلی ایجاد کننده عفونت ادراری اختلاف معنی­دار وجود دارد (05/0 Pvalue<  به­دست آمده است). به­عبارتی دیگر بین درصد فراوانی حضور هر یک از این سه ژن در نمونه­های مورد مطالعه در این تحقیق تفاوت وجود داشته است و این سه ژن (در مقایسه با هم­زمانی حضور هر سه ژن با هم) با فراوانی­های متفاوت می­توانند در باکتری  اشریشیاکلی عامل عفونت ادراری وجود داشته باشند. هم­چنین این سه ژن با توجه­به فراوانی بیش­تر نمونه­ها از جنس مؤنث، در خانم­ها با درصد بالاتری حضور داشتند که نتایج درصد فراوانی حضور آن­ها به تفکیک جنسیت در نمودار 3 نشان داده شده است.

بحث

باکتری اشریشیاکلی که در بیش از 80 درصد موارد عفونت دستگاه ادراری به­عنوان باکتری بیماری­زا است با حضور ژن­های پاتوژن مختلف که با توانایی بیماری­زایی باکتری ارتباط دارد، همراه است (14، 15) هم­چنین جهت افزایش سرعت و دقت تشخیص و کنترل پیشرفت عفونت در میزبان و درمان مناسب، شناخت خصوصیت­های بیماری­زایی ارگانیسم مهاجم، از جمله حضور ژن­های پاتوژن در عامل عفونت، ضروری است. بنابراین در این مطالعه شناسایی هم­زمان 3 ژن بیماری­زایی kpsMTII، iucD  و usp در  اشریشیاکلی ایجاد کننده عفونت ادراری با روش Multiplex-PCR  انجام گرفته است و نتایج این تحقیق نشان داد این 3 فاکتور، در 33/28 درصد نمونه­ها حضور هم­زمان داشتند. هم­چنین بین فراوانی حضور این سه ژن در نمونه­های اشریشیاکلی ایجاد کننده عفونت ادراری مورد مطالعه، ارتباط معنی­داری وجود داشت. لذا بر اساس نتایج این پژوهش و مطالعه­هاب مشابه که در این خصوص انجام گرفته است بین حضور این ژن­های بیماری­زا در باکتری اشریشیاکلی و کلونیزاسیون و گسترش عفونت توسط این باکتری در ایجاد عفونت ادراری می­تواند ارتباط وجود داشته باشد (14، 15،18،20، 22). برای تأیید وجود این ارتباط با حضور ژن­های بیماری­زا در باکتری اشریشیاکلی ایجاد کننده عفونت ادراری، بررسی و مقایسه­ایی بین نتایج مطالعه­های پیشین و نتایج تحقیق حاضر، انجام گرفته است.

Bauer و همکارانش در سال 2002 در مورد شناسایی و اپیدمیولوژی 3 ژن بیماری ­زا usp, iha و iroN در باکتری اشریشیاکلی ایجاد کننده عفونت ادراری تحقیق کردند. نتایج آن­ها نشان داد عامل usp، پروتئین اختصاصی بیماری­زا است و نقش مهمی در ایجاد عفونت ادراری دارد. عامل iha، نوعی چسبنده و ادهسین است. عامل iroN، سیستم اکتساب آهن در باکتری است که سبب جذب اهن از محیط و عفونت­زایی باکتری می­شود. آئروباکتین­ها و سیدروفورها نیز آهن­بر هستند. iroN عامل به­دست آوردن سیدروفور، انتروباکتین است و به­عنوان گیرنده سیدروفور کاتکولات عمل می­کند (16). در این پژوهش نیز علاوه­بر عامل usp ، عوامل kpsMTII و iucD که ژن­های پاتوژن بوده و در کلونیزاسیون و بیماری­زایی باکتری می­توانند نقش داشته باشند، به­طور هم­زمان با روش Multiplex-PCR  مورد شناسایی قرار گرفتند Kanamaru .و همکارانش در سال 2003 بر روی عوامل ویرولانس kpsMT ,usp ,iroN ,iha ,ompT در باکتری اشریشیاکلی ایجاد کننده عفونت ادراری با روش PCR تحقیق کردند. نتایج آن­ها نشان داد kpsMTII نوعی کپسول باکتریایی است و سبب مقاومت باکتری می­شود. هم­چنین باعث کلونیزاسیون باکتری نیز می­شود.  iroN سیستم اکتساب آهن باکتری را کنترل نموده و باعث می­شود باکتری آهن را از محیط جذب کند و عفونت­زا گردد. usp  پروتئین اختصاصی بیماری­زایی است.ompT  پروتئاز غشای خارجی است و نوعی آنزیم برای باکتری محسوب می­شود. Iha نوعی چسبنده و ادهسین است و چسبنده دیگر، fimH نیز وجود دارد. آن­ها بیش­ترین فراوانی را برای ژن ompT و کم­ترین فراوانی را مربوط به ژن iroN گزارش نمودند. بنابراین تمامی این ژن­ها می­توانند در بیماریزایی باکتری مؤثر باشند (17). در این تحقیق نیز حضور سه ژن موثر در بیماری­زایی، شامل kpsMTII، iucD  و usp در نمونه­های باکتری اشریشیاکلی مورد بررسی قرار گرفته است و در مقایسه با بررسی حضور تک تک ژن­ها در مطالعه Kanamaru  ، حضور هم­زمان این ژن­ها با روش Multiplex PCR مطالعه شد و وجود اختلاف معنی­دار، بین حضور این سه ژن مطالعه شده، مشاهده شد که می تواند گویای فراوانی مستقل از هم، این عوامل در باکتری مورد مطالعه باشد Arisoy. و همکارانش در سال 2006 تحقیقی را در مورد عوامل بیماری­زایی باکتری اشریشیاکلی ایجاد کننده عفونت ادراری در کودکان توسط Multiplex-PCR انجام دادند. نتایج آن­ها مشخص نمود فاکتورهای iroN ,iucD ,fimH شایع­ترین ژن­های بیماری­زای باکتری اشریشیاکلی هستند که می­توانند هم­زمان حضور داشته باشند (14). در این تحقیق نیز که همانند تحقیق آنان با روش Multiplex PCR در خصوص هم­زمانی حضور سه عامل بیماری­زا kpsMTII، iucD  و usp انجام گرفت، مشاهده شد که در نمونه­های باکتری اشریشیاکلی ایجاد کننده عفونت ادراری، عوامل بیماری­زای، kpsMTII، iucD  و usp با فراوانی­های متفاوت به­ترتیب در 7/71 درصد، 3/88 درصد و 7/36 درصد نمونه­ها، حضور داشتند و بین حضور این ژن­ها در نمونه­های مورد مطالعه ارتباط معنی­دار وجود داشت. Oliveria و همکارانش در سال 2011 در برزیل در مورد عوامل بیماری­زا و مقاومت آنتی­بیوتیکی باکتری اشریشیاکلی ایجاد کننده عفونت ادراری با روش مولکولی PCR تحقیقی را انجام دادند. نتایج آن­ها مشخص نمود، هر یک از ژن­هایی که پاتوژن هستند شامل، کپسول باکتری (kpsMTII که چسبنده یا ادهسین­های (فیمبریه تیپ 1) هستند، سیستم اکتساب آهن یا سیدروفورها (iucD) ، پروتئین­های اختصاصی بیماری­زایی (usp) ،آلفا همولیزین، توکسین­ها (اندوتوکسین) و فاکتور نکروزدهنده سایتوتوکسیک، می­توانند باعث شدت بیماری­زایی و ایجاد عفونت در بیماران شوند (18). در این تحقیق نیز که با روش مولکولی Multiplex-PCR در خصوص سه ژن بیماری­زای kpsMTII،  iucDو usp انجام گرفت در نمونه­های باکتری  اشریشیاکلی ایجاد کننده عفونت ادراری، سه عامل ایجاد عفونت مشابه عوامل مورد بررسی در تحقیق Oliveria بررسی شدند و نتایج این پژوهش نشان داد که سه ژن مذکور می­توانند در 33/28 درصد موارد هم­زمان حضور داشته باشند و بین حضور این عوامل در  باکتری­هایی که در ایجاد عفونت ادراری نقش داشتند ارتباط وجود دارد و در نتیجه این عوامل هم می­توانند به­طور هم­زمان و هم به­صورت جداگانه در ایجاد عفونت مؤثر باشند. Cunha و همکاران در سال 2017 پژوهشی را بر روی عوامل بیماری­زای سویه­های باکتری  اشریشیاکلی خارج روده­ایی که سبب عفونت ادراری می­شوند با روش مالتی لوکوس سکوئنسینگ انجام دادند. آنان مشخص نمودند برخی عوامل بیماری­زا با درصد بالا و برخی ژن­ها با میزان فراوانی کم­تر در نمونه­های ایجاد کننده عفونت ادراری حضور دارند. از عواملی که فراوانی بیش­تری داشتند می­توان ژن­های   pap(85%)، sfa (100%)، usp (100%)، cnsf1 (22%)، kpsMTII (66%)، hlyA (52%) را نام برد و از ژن­های با حضور کم­تر می­توان به ژن­های tsh, ompT و hlyF هر یک با فراوانی 8% و ژن­های cvi/cva با فراوانی صفر اشاره نمود (19). در تحقیق حاضر نیز که با روش Multiplex PCR انجام شد، حضور دو ژن kpsMTII و iucD همانند عوامل مورد بررسی در تحقیق Cunha ، با میزان فراوانی بالا به­ترتیب در 7/71 درصد و 3/88 درصد نمونه ها مشاهده شد ولی ژن usp با فراوانی کم­تر نسبت­به تحقیق Cunha در 7/36 درصد نمونه­ها گزارش شده است که می­تواند ناشی از تفاوت در نوع و تعداد جمعیت نمونه­های مورد مطالعه و روش کار انجام گرفته باشد. در تحقیقی که Darko و همکارانش در سال 2013 در خصوص عوامل ویرولانس باکتری اشریشیاکلی ایجاد کننده عفونت ادراری، با روش PCR انجام دادند مشخص شد که عامل usp که یک پروتئین اختصاصی در عفونت ادراری و همولوگ ژن توکسین ویبریوکلرا است، با بیش­ترین فراوانی (48/72 درصد) در 149 جدایه باکتریایی حضور دارد. هم­چنین در ان تحقیق حضور عامل papC که یک فیمبریای چسبنده به سلول­های اپیتلیال ادراری است، نیز شناسایی شد و بین حضور این دو عامل در نمونه­های مورد مطالعه ارتباط معنی­داری یافته شد (20). در مطالعه حاضر که با روش متفاوت از روش آن­ها ( Multiplex PCR ) انجام گرفته است، حضور ژن usp با میزان فراوانی 7/36 درصد در نمونه­های مورد بررسی مشاهده شد. هم­چنین نتایج نشان داد که بین حضور هم­زمان سه عامل بیماری­زا kpsMTII، iucD و usp در باکتری­های اشریشیاکلی ایجاد کننده عفونت ادراری در نمونه­های مورد بررسی ارتباط معنی­داری وجود دارد.  Momtaz و همکاران در سال 2013 تحقیقی را بر روی عوامل بیماری­زا و فاکتورهای مقاومت به دارو در سویه­های باکتری اشریشیاکلی ایجاد کننده عفونت ادراری، با روش PCR انجام دادند. نتایج تحقیق آن­ها نشان داد که ژن بیماری­زای fim با بیش­ترین فراوانی و ژن usp با کم­ترین فراوانی از بیماران با عفونت ادراری جداسازی شد. بررسی آنان بر روی 123 نمونه باکتریایی و شناسایی چندین فاکتور بیماری­زا و ژن­های مقاومت به آنتی­بیوتیک صورت گرفته است و بر روی سروتایپ­های جدا شده از بیماران ایرانی مطالعه را انجام داده­اند (21). در تحقیق حاضر که جداسازی هم­زمان 3 ژن بیماری­زای kpsMTII، iucD و usp با روش Multiplex PCR مشابه تحقیق Momtaz  در جامعه بیماران ایرانی انجام شده، درصد حضور هم­زمان 3 ژن 33/28% و درصد حضور ژن usp با فراوانی کم­تر نسبت­به دو ژن دیگر در 7/36 درصد نمونه­ها گزارش شد که از این نظر مشابه با نتایج مطالعه Momtaz بوده است ولی از نظر روش کار و تعداد و جمعیت نمونه­ها دو مطالعه با هم تفاوت دارند. Mohammadi و همکاران در سال 2017 به­منظور شناسایی ژن­های بیماری­زایی در سویه­های باکتری  اشریشیاکلی ایجاد کننده عفونت ادراری، به­روش Multiplex-PCR  تحقیقی را انجام دادند. در ان مطالعه به­منظور شناسایی ژن­های iha، iroN و ompT در جدایه­هایی از نمونه­های بالینی تعداد 200 نمونه ادرار جمع­آوری گردید. نتایج آنان نشان داد 100 درصد نمونه دارای 1، 2 یا هر 3 ژن بیماری­زایی به­صورت هم­زمان هستند. در تحقیق آنان بیش­ترین فراوانی مربوط به ژن iha با 7/56 درصد و کم­ترین فراوانی مربوط به ژن iroN به میزان 20 درصد گزارش شد (22). در این تحقیق که مشابه تحقیق Mohammadi  با روش Multiplex PCR در نمونه­های باکتری اشریشیاکلی ایجاد کننده عفونت ادراری انجام شده است، حضور هم­زمان 3 عوامل بیماری­زای، kpsMTII ، iucD و usp در 33/28 درصد مشاهده شد. هم­چنین بین حضور این عوامل بیماری­زا در نمونه­های باکتری اشریشیاکلی ایجاد کننده عفونت ادراری مورد بررسی، اختلاف معنی­داری وجود داشت که می­نواند گویای نقش مستقل هر یک از ژن­ها در بیماری­زایی باکتری باشد. 

بنابراین با مقایسه تحقیق حاضر و تحقیقات گذشته در این زمینه، تشابهات و تفاوت­هایی مشاهده می­شود که در توجیه تفاوت­های موجود می­توان به تفاوت اقلیم و مناطق جغرافیایی و یا نژادهای ملیتی و انواع سروتایپ­هایی که در جمعیت­های مختلف سبب عفونت می­شود، می­توان اشاره نمود. هم­چنین تفاوت در تعداد نمونه­های ایزوله شده و نوع عوامل بیماری­زای مورد مطالعه و روش­های متفاوت شناسایی آن­ها مطرح است. اما نکته اصلی حضور این عوامل بیماری­زا در سویه­های باکتری اشریشیاکلی ایجاد کننده عفونت ادراری است که سبب شدت و گسترش عفونت شده و مانعی برای کنترل و درمان مناسب محسوب می­شود. بنابراین با شناخت و آگاهی از حضور این ژن­ها در سویه­های بیماری­زا می­توان تمهیداتی را برای ارتقای سطح بهداشت عمومی جامعه و کنترل عفونت­ها اندیشید، که حائز اهمیت است.

نتیجه­گیری

در پژوهش حاضر حضور هم­زمانی سه عوامل بیماری­زای، kpsMTII، iucD و usp، که از ژن­های پاتوژن در باکتری اشریشیاکلی عامل عفونت ادراری هستند جهت پیش­بینی روند پیشرفت و کنترل عفونت و در نتیجه درمان مناسب بیماری مورد بررسی قرار گرفته است و براساس نتایج حاصل از تحقیق چنین نتیجه­گیری می­شود که این سه ژن بیماری­زا هم می­توانند به­طور هم­زمان حضور داشته باشند و سبب تشدید عفونت­زایی باکتری شوند و هم با توجه­به معنی­دار بودن تفاوت حضور این سه ژن در نمونه­های مورد مطالعه، عوامل مذکور می­توانند با فراوانی­های متفاوت در باکتری بیماری­زا حضور داشته باشند در نتیجه دارای اثرهای متفاوت در گسترش و کلونیزاسیون عفونت توسط این باکتری در بین بیماران باشند که این مسئله می­تواند در تحقیقات متخصصین اپیدمیولوژی مورد توجه قرار گیرد.

سپاسگزاری

این مقاله مستخرج از پایان­نامه کارشناسی ارشد دانشجویی در دانشکده علوم زیستی دانشگاه آزاد اسلامی واحد تهران شمال است و جا دارد از کلیه مسئولین محترم دانشگاه و دانشکده مذکور و همکاران محترم آزمایشگاه پاسارگارد که در انجام کارهای آزمایشگاهی این پایان نامه کمال همکاری را مبذول فرموده­اند، تشکر و قدردانی گردد.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

منابع

1.Luthje P, Brauner A. Virulence factors of uropathogenic E. coli and their interaction with the host. Adv  microb phys. 2014; 65: 337-372.

2. Subashchandrabose S, Mobley HLT. Virulence and Fitness Determinants of Uropathogenic Escherichia coli. Microb spec. 2015; 3(4): 1-32.

3. Tarchouna M, Ferjani A, Ben-Selma W, Boukadida J. Distribution of uropathogenic virulence genes in Escherichia coli isolated from patients with urinary tract infection. Inter J infec Dis. 2013; 17(6): e450-453.

4. Chahales P, Thanassi DG. Structure, Function, and Assembly of Adhesive Organelles by Uropathogenic Bacteria. Micro spec. 2015; 3(5): 1-68.

5. Tabasi M, Karam MR, Habibi M, Mostafavi E, Bouzari S. Genotypic Characterization of Virulence Factors in Escherichia coli Isolated from Patients with Acute Cystitis, Pyelonephritis and Asymptomatic Bacteriuria. J Clin Diagn Res. 2016; 10(12): 1-7.

6. Waller TA, Pantin AL, Yenior AL, Pujalte GA. Urinary Tract Infection Antibiotic Resistance in the United States. Prim care. 2018; 45(3): 455-466.

7. Dan M, Yair Y, Samosav A, Gottesman T, Yossepowitch O, Harari-Schwartz O. Escherichia coli isolates from patients with bacteremic urinary tract infection are genetically distinct from those derived from sepsis following prostate transrectal biopsy. Inter J Med Microb. 2015; 305(4-5): 464-8.

8. Terlizzi ME, Gribaudo G, Maffei ME. UroPathogenic Escherichia coli (UPEC) Infections: Virulence Factors, Bladder Responses, Antibiotic, and Non-antibiotic Antimicrobial Strategies. Fron Microb. 2017; 8: 1566.

9. Kargar M, Kargar M, Zareian Jahromi M. Prevalence of Virulence Genes of Escherichia Coli O157:H7 Isolated from Patients with Urinary Tract Infections in Shiraz, Iran. Med Lab J. 2015; 9(3): 9-16.

10. Millan Y, Hernandez E, Millan B, Araque M. Distribution of phylogenetic groups and virulence factors in CTX-M-15 beta-lactamase-producing uropathogenic Escherichia coli strains isolated from patients in the community of Merida, Venezuela. Rev Arg Microb. 2014; 46(3): 175-181.

11. Kudinha T, Kong F, Johnson JR, Andrew SD, Anderson P, Gilbert GL. Multiplex PCR-based reverse line blot assay for simultaneous detection of 22 virulence genes in uropathogenic Escherichia coli. Appl Env Microb. 2012; 78(4): 1198-1202.

12. Tiba MR, Yano T, Leite Dda S. Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis. Revista do Instituto de Medicina Tropical de Sao Paulo. 2008;50(5):255-60.

13. McLellan LK, Hunstad DA. Urinary Tract Infection: Pathogenesis and Outlook. Trend Molecul Med. 2016;  22(11): 946-957.

14. Arisoy M, Aysev D, Ekim M, Ozel D, Kose SK, Ozsoy ED, et al.  Detection of virulence factors of Escherichia coli from children by multiplex polymerase chain reaction. I J Clin Prac. 2006; 60(2): 170-173.

15. Alishah M, Amini K, Zahraei Salehi T. Detection of virulence genes in Escherichia coli strains isolated from pediatric with urinary tract infection and their antibiotic resistance profile. J Urmia Uni Med Sci. 2017; 27(11): 942-949. (Full Text in Persian)

16. Bauer RJ, Zhang L, Foxman B, Siitonen A, Jantunen ME, Saxen H, et al.. Molecular epidemiology of 3 putative virulence genes for Escherichia coli urinary tract infection-usp, iha, and iroN(E. coli). J Infec Dis. 2002; 185(10): 1521-1524.

17. Kanamaru S, Kurazono H, Ishitoya S, Terai A, Habuchi T, Nakano M, et al. Distribution and genetic association of putative uropathogenic virulence factors iroN, iha, kpsMT, ompT and usp in Escherichia coli isolated from urinary tract infections in Japan. J Urol. 2003; 170(6 Pt 1): 2490-2493.

18. Oliveira FA, Paludo KS, Arend LN, Farah SM, Pedrosa FO, Souza EM, et al. Virulence characteristics and antimicrobial susceptibility of uropathogenic Escherichia coli strains. Genetics and molecular research. Genet Mol Res. 2011; 10(4): 4114-4125.

19. Cunha MPV, Saidenberg AB, Moreno AM, Ferreira AJP, Vieira MAM, Gomes TAT, et al. Pandemic extra-intestinal pathogenic Escherichia coli (ExPEC) clonal group O6-B2- ST73 as a cause of avian colibacillosis in Brazil. PLOS ONE. 2017; 12(6): e0178970.

20. Darko SN, Kwabena Nsiah  K, Twumasi  P. Prevalence of papC and usp Virulence Factors in Uropathogenic Escherichia coli Causing Asymptomatic Urinary Tract Infections in Adolescents. British Microb Res J. 2013; 3(3):  423-430.

21. Momtaz H, Karimian  A, Madani  M, Safarpoor Dehkordi  F, Ranjbar  R, Sarshar  M, et al. Uropathogenic Escherichia coli in Iran: Serogroup distributions, virulence factors and antimicrobial resistance properties. Annal Clin Microb Antimicrob. 2013, 12(8): 1-12.

22. Mohammadi J, Amini K. Detection of virulence genes in Uropathogenic E. coli (UPEC) strains by Multiplex-PCR method. J Fasa Uni Med Sci. 2017; 7(1): 128-133. (Full Text in Persian)

 

نوع مطالعه: مقاله پژوهشی | موضوع مقاله: سلولی و مولکولی
دریافت: 1399/2/24 | پذیرش: 1399/2/24 | انتشار: 1399/2/24

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله تازه های بیوتکنولوژی سلولی - مولکولی می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2022 CC BY-NC 4.0 | New Cellular and Molecular Biotechnology Journal

Designed & Developed by : Yektaweb