دوره 10، شماره 40 - ( 6-1399 )                   جلد 10 شماره 40 صفحات 113-103 | برگشت به فهرست نسخه ها

XML English Abstract Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Siasi E, Aleyasin A. Association of rs737008 in PRM1 and rs4780356 in PRM2 Polymorphisms with Idiopathic Infertility in Iranian men. NCMBJ. 2020; 10 (40) :103-113
URL: http://ncmbjpiau.ir/article-1-1318-fa.html
سیاسی الهام، ال یاسین احمد. ارتباط پلی مورفیسم های rs737008 در ژن PRM1 و rs4780356 در ژن PRM2 با ناباروری ادیوپاتیک مردان ایرانی. مجله تازه هاي بيوتكنولوژي سلولي و مولكولي. 1399; 10 (40) :113-103

URL: http://ncmbjpiau.ir/article-1-1318-fa.html


گروه ژنتیک پزشکی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری ،تهران ، ایران
متن کامل [PDF 4511 kb]   (491 دریافت)     |   چکیده (HTML)  (1813 مشاهده)
متن کامل:   (738 مشاهده)

ارتباط پلی ­مورفیسم­ های rs737008 در ژن PRM1 و

 rs4780356 در ژن PRM2 با ناباروری ادیوپاتیک مردان ایرانی

الهام سیاسی *1، احمد ال یاسین2.

1- گروه ژنتیک، دانشکده علوم زیستی، دانشگاه آزاد اسلامی ،واحد تهران شمال، تهران، ایران.

2- گروه ژنتیک پزشکی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری ،تهران ، ایران.


چکیده

سابقه و هدف: در روند اسپرماتوژنز پستانداران، پروتئین­های پروتامین با اتصال به DNA سر اسپرم، جایگزین هیستون­ها شده و سبب بلوغ اسپرم می­شوند. تغییر در ژن­های کدکننده پروتامین­ها منجر به آسیب DNA اسپرم و در نتیجه ایجاد ناباروری در مردان می­گردد. بنابراین هدف این تحقیق بررسی ارتباط دو پلی­مورفیسم rs737008 در ژن PRM1 و rs4780356 در ژن PRM2 با ایجاد ازواسپرمی و الیگواسپرمی در مردان نابارور ادیوپاتیک ایرانی بود.

مواد و روش­ها: از نمونه خون 96 مرد نابارور ادیوپاتیک که ازواسپرم و اولیگو اسپرم بودند و 100 نفر گروه کنترل، استخراج DNA انجام گرفت. حضور دو پلی­مورفیسم مورد مطالعه با روش PCR-RFLP بررسی شد .سپس نتایج با روش Sequencing تأیید شدند.

یافته­ ها: فراوانی آلل موتان A از پلی­مورفیسم rs737008 در ژن PRM1 در مقایسه بین گروه بیمار با  گروه کنترل متفاوت بود ولی با آنالیز آماری اختلاف معنی­دار بین حضور این پلی­مورفیسم بین گروه بیمار و کنترل مشاهده نشد (05/0 <P ). با ژنوتایپینگ حضور پلی­مورفیسم rs4780356 در ژن PRM2، در هیچ­یک از گروه بیمار و کنترل مشاهده نشد.

نتیجه­ گیری: یافته­های این تحقیق مشخص نمود که ارتباطی بین حضور دو پلی­مورفیسم rs737008 در ژن PRM1 و rs4780356 در ژن PRM2 با ایجاد ازواسپرمی و اولیگواسپرمی و در نتیجه ناباروری ادیوپاتیک جمعیت مردان ایرانی، وجود ندارد. مطالعه­های بیش­تر نیاز است تا نقش این دو پلی­مورفیسم با ایجاد ناباروری ادیوپاتیک در مردان ایرانی مشخص گردد.

واژه ­های کلیدی: ناباروری مردان، پلی­ مورفیسم، ژن­های PRM1 و PRM2، PCR-RFLP.


 

مقدمه

ناباروری در میان 15 درصد زوجین در دنیا وجود دارد ولی در ایران این میزان از آمار جهانی بالاتر است و در حدود 50 درصد از موارد به­دلیل ناباروری در مردان[1] است. ناباروری مردان به­عنوان یک بیماری کمپلکس مطرح بوده که در بیش از نیمی از موارد به­علل ناشناخته است و در 15 درصد موارد به­علت ناهنجاری­های کروموزومی و تغییرهای ژنتیکی است (2،1). از سایر عوامل ناباروری می‌توان به اختلال در تعداد، حرکت و مورفولوژی اسپرم و اختلال­های ساختمانی، عدم تعادل هورمونی و عوامل ژنتیکی که در روند اسپرماتوژنز دخالت دارند، اشاره نمود (1،2،3). عوامل ژنتیکی که تا به امروز مشخص شده‌اند و در ناباروری مردان مؤثر هستند، عبارتند از: اختلال­های کرموزومی، بیماری­های تک ژنی، اختلال در میوز و اندوکرین (2،4). علی­رغم تمام عوامل ذکر شده، 25% از مردان نابارور دارای آنالیز اسپرم غیرطبیعی هستند که هیچ اتیولوژی برای آن­ها شناسایی نشده است. این حالت را ناباروری ادیوپاتیک مردان می‌نامند، که با دلایل ژنتیکی متعددی مشخص می‌شود (4،5،6). از عوامل ایجاد کننده ناباروری ادیوپاتیک، که با بررسی کیفیت اسپرم مشخص شده­اند، می­توان به فاکتورهای ژنتیکی هم­چون ژن­های کروموزوم Y، ژن رسپتور اندروژن و ژن­های تنظیم کننده هورمون­های جنسی، تغییرهای اپی­ژنتیک و اشکال غیرمعمولIncRNA, miRNA, piRNA, RNAها که روی پروسه اسپرماتوژنز تأثیر می­گذارند، اشاره نمود (1،2،5).

اسپرماتوژنز روند حیاتی برای تکامل اسپرم است که با تراکم هیستون­های هسته اسپرم کامل می­شود. پروتئین­های پروتامین با جایگزین شدن به­جای هیستون­ها در مرحله­های تمایز هسته اسپرم در بلوغ سلول­های اسپرم نقش دارند. این پروتئین­ها غنی از اسید آمینه‌های آرژنین و سیستئین هستند، که برای تشکیل باندهای DNA و پل­های دی­سولفیدی در هسته اسپرم و تجمیع در قسمت سر اسپرم مورد نیاز هستند (2،7،8). دسته اول پروتئین­های پروتامینی با ژن­های PRM کد می­شوند. تمامی پستانداران دارای ژن PRM1 برای پروتامین‌ها هستند اما انسان و موش علاوه­بر آن، ژن PRM2 را نیز دارند. این ژن‌ها در لوکوس مولتی ژنی در ناحیه‌ای به­طول 28 کیلو باز روی کروموزوم 16 که در روند اسپرماتوژنز دخالت دارند قرار دارند و تغییر در آن­ها سبب ایجاد آزواسپرمی و اولیگواسپرمی در مردان می­گردد. در تحقیقات گذشته مشخص شده است که بین حضور برخی پلی‌مورفیسم­ها و جهش­ها در ژن­های پروتامین­ها، با ناباروری مردان ارتباط وجود دارد. این ارتباط می­تواند با اثرهای آن تغییرهای ژنتیکی بر روی روند اسپرماتوژنز و دخالت در تغییرها پس از ترجمه پروتئین­هایی که در تشکیل اسپرم بالغ مؤثر هستند، همراه باشد. در نتیجه باعث ناباروری و پیامدهایی هم­چون تغییر در هورمون­های مردانه، ایجاد الیگواسپرمی یا ازواسپرمی، عدم توانایی ورود اسپرم به تخمک، انجام نپذیرفتن لقاح موفق و هم­چنین عدم رشد جنین (حتی در لقاح آزمایشگاهی) می­گردد (8،9،10). مطالعه­ها روی انواع پروتامین­ها و نقشی که در روند اسپرماتوژنز دارند مشخص نموده است که تنظیم­های اپی­ژنتیک هم­چون تغییرها و بازارایی­های پروتئین­های هیستونی و نقش آن­ها بر عوامل رمدلینگ کننده کروماتین­ها می­تواند در جایگزینی پروتامین­ها به­جای هیستون­ها در پروسه تجمیع هسته اسپرم و تشکیل سلول­های جنسی بالغ در روند اسپرماتوژنز تأثیرگذار باشد. هم­چنین وجود پروتامین­ها در بسته­بندی صحیح کروماتین که بر عملکرد و حرکت اسپرم بالغ تأثیر دارد و نقش هیدرودینامیکی سر اسپرم که در حفظ اطلاعات ژنتیکی اسپرم مؤثر است ضروری هستند (3،8،10).  

بنابراین بررسی مکانیسم­های مولکولی در خصوص جایگزینی پروتئین­های پروتامینی در هسته اسپرم می­تواند مشخص کننده بیومارکرهای اپی­ژنتیکی برای شناسایی مردان نابارور بوده و با پتانسیل بالا در درمان این بیماران مطرح باشند. از این رو در این مطالعه به بررسی ارتباط بین حضور دو پلی­مورفیسم rs737008 در ژن PRM1 و rs4780356 در ژن PRM2 و ناباروری ادیوپاتیک مردان ایرانی با روش PCR-RFLP (Restriction Fragment Length Polymorphism) پرداخته شد و نتایج ژنوتایپینگ، با روش تعیین توالی (Sequencing) تأیید شدند.

مواد و روش­ها

نمونه‌گیری- در این تحقیق، 96 مرد نابارور که به­دلایل علل ناشناخته ژنتیکی، نابارور ادیوپاتیک تشخیص داده شده بودند و با کسب رضایت­نامه و اگاهی افراد از مطالعه، برای نمونه­گیری انتخاب شدند. این مردان دو زیر گروه، آزواسپرم که فاقد اسپرم و 77 نفر بودند و اولیگو اسپرم که دارای کم­تر از پنج میلیون سلول اسپرم در میلی­لیتر و 19 نفر بودند، را شامل می‌شدند که گروه بیمار بودند. آنان در گروه سنی 30 تا 45 سال قرار داشتند. گروه کنترل شامل 100 نفر از مردان بارور سالم بود، که درگروه سنی مشابه قرار داشتند و از نظر پارامترهای فیزیولوژی و ساختمانی و نتایج کاریو تایپینگ دارای حالت نرمال بودند و دارای حداقل یک فرزند بودند. برای نمونه­گیری، از کلیه افراد 5 میلی­لیتر خون محیطی در فالکون­های حاوی 500 میکرولیتر محلول آنتی­کوالانت EDTA (با غلظت µM 10-1 و pH برابر با 6-4) و میزان 100 میکرولیتر به ازاء هر یک میلی­لیتر خون محیطی گرفته شد. نمونه‌های خون تا زمان استخراج DNA از هسته گلبول­های سفید خون در دمای C˚20- نگهداری شدند.

انجام روش­های مولکولی برای بررسی حضور پلی­مورفیسم­های  rs737008 در ژن PRM1 و rs4780356 در ژن PRM2

استخراج DNA و کنترل کیفیت ژنوم استخراج شده- استخراج DNA ژنومیک از خون، با روش استخراج نمکی DNA انجام گرفت. به­منظور ارزیابی کمیت و کیفیت DNAهای استخراج شده و آگاهی از غلظت و درجه خلوص آن، از دستگاه نانو دراپ و الکتروفورز روی ژل اگاروز استفاده شد.

انجام PCR و الکتروفورز محصول PCR - واکنش PCR برای تکثیر هریک از پلی­مورفیسم­های مورد مطالعه، با مواد مورد نیاز و پرایمر‌ها و برنامه دستگاه PCR که به­ترتیب در جداول 1 و 2 و 3 آورده شده است، انجام گرفت. سپس صحت محصولات PCR با الکتروفورز روی ژل اگاروز و عکس­برداری با دستگاه ژل داک کنترل شد.

 

جدول 1- مواد مورد نیاز برای واکنش PCR

مواد مورد نیاز

 

حجم

(میکرولیتر)

آب مقطر دونیزه

19

بافر PCR

5/2

Mgcl2

1

dNTP

5/0

هر یک از پرایمر‌های راست و چپ

5/0

DNA ژنومی نمونه مورد نظر

2/1-1

آنزیم Taq پلی­مراز

2/0

حجم نهایی

25

جدول 2- مشخصات پرایمرهای مورد استفاده در انجام PCR

نام ژن

 

توالی پرایمرها

رفرنس

PRM1

 

F- cccctggcatctataacaggccgc

R-tcaagaacaaggagagaagagtgg

11

PRM2

 

F- ctccagggcccactgcagcctcag

R- gaattgctatggcctcacttggtg

11

 

جدول 3- برنامه PCR برای تکثیر پلی‌مورفیسم­های مورد مطالعه.

نام ژن

مرحله دناتوره شدن

دما زمان

مرحله اتصال آغازگر

دما - زمان

مرحله طویل شدن

دما - زمان

تعداد سیکل

PCR

طول قطعه تکثیر شده

bp

PRM1

°C94- 1دقیقه

°C66-1دقیقه

°C72-1دقیقه

32

557

PRM2

°C94-45ثانیه

°C70-45ثانیه

°C72-45ثانیه

32

599

·         زمان و دمای دناتوره شدن اولیه برای دو پلی‌مورفیسم تکثیر داده شده به­ترتیب °C94 و 5 دقیقه  بود.

·         زمان و دمای طویل شدن نهایی برای دو پلی‌مورفیسم تکثیر داده شده به­ترتیب °C72 و 5 دقیقه بود.

 

انجام روش RFLP برای تشخیص پلی­مورفیسم­ها- پس از انجام PCR، برای بررسی حضور دو پلی­مورفیسم مورد مطالعه از روش RFLP و هضم آنزیمی محصول PCR با  آنزیم­های محدودالاثر استفاده شد. روش کار و مواد و محلول‌های مورد استفاده برای انجام RFLP عبارت بود از: یک میکرولیتر از محصول PCR با یک میکرولیتر بافر X 10 و 2/0 میکرولیتر آنزیم 10 یونیت بر میکرولیتر که هر 1/0 آن معادل 1 میکرولیتر است، مخلوط شد و حجم کلی را با کمک آب دیونیزه به حجم 10 میکرولیتر رسانده شد. سپس نمونه‌ها را به­مدت 16-2 ساعت در دماهای °C37 و °C65 که دماهای بهینه به­ترتیب برای آنزیم­های Bstu I و Bsr I (تهیه شده از شرکت تکاپوزیست) هستند، قرار داده شد. پس از هضم آنزیمی، ژنوتایپینگ نمونه­ها با الکتروفورز نمودن محصول PCR-RFLP روی ژل آگاروز 5/1 % انجام گردید. مشخصات آنزیم­های برش دهنده در این تحقیق در جدول 4 آورده شده است.

 

 

جدول 4- قطعه­های ناشی از هضم آنزیمی محصول­های PCR به­دنبال استفاده از روش RFLP

ژن

پلی‌مورفیسم

آنزیم

سایت برش

برش آللی

طول PCR

طول قطعات حاصل بعد از برش bp

PRM1

Rs737008

Bstu I

CG/CG

آلل وحشی

557

557 و 361 و 196

PRM2

rs4780356

Bsr I

C/CAGT

آلل وحشی

599

599 و 400 و 199

 

 

تأیید صحت نتایج ژنوتایپینگ- برای تعیین سکانس و تأیید محصولات PCR-RFLP نمونه­هایی از هموزیگوت غالب و هموزیگوت مغلوب و هتروزیگوت­ها انتخاب شده و پس از خالص­سازی با کیت سیناکلون، از طرف شرکت تکاپوزیست به کشور کره جنوبی (به شرکت بایونیر) برای تعیین توالی فرستاده شدند. تعیین توالی انجام شد و در نهایت بلاست انجام گرفت.

 

آنالیزهای آماری- برای آنالیز نتایج تحقیق از برنامه آماری SPSS و آزمون (Chi-square ) X2در سطح معنی­دار 05/0 برای بررسی تفاوت­های فراوانی آلل­ها استفاده شد.

 

یافته ­ها

نتایج نمونه­ها- گروه بیمار مردان نابارور ازواسپرم و اولیگواسپرم را شامل می‌شدند. این افراد توسط پزشک متخصص اورولوژی مورد بررسی قرار گرفتند. با انجام یک سری آزمایش­های اندرولوژی روی بیماران شامل بررسی تاریخچه پزشکی، معاینه­های فیزیکی، آنالیز مایع سیمن، آنالیز هورمونی برای میزان LH, FSH، بررسی کاریوتایپ بیماران و در برخی موارد بیوپسی بیضه، مردان ناباروری که ادیوپاتیک تشخیص داده شدند، انتخاب شدند. نتایج دموگرافی افراد مورد مطالعه در جدول 5 آورده شده است.

نتایج ژنوتایپینگ برای تشخیص پلی‌مورفیسم­های rs737008 در ژن PRM1 و rs4780356 در ژن PRM2-برای بررسی دو پلی­مورفیسم مورد مطالعه از تکنیک PCR – RFLP (هضم آنزیمی با آنزیم­های برش دهنده محصول PCR ) استفاده گردید. نتایج ژنوتایپینگ، حضور پلی­مورفیسم rs4780356 در ژن PRM2، را در هیچ­یک از گروه بیمار و کنترل نشان نداد و برای پلی­مورفیسم rs737008 در ژن PRM1 در مقایسه بین گروه بیمار با گروه کنترل آلل موتان A فراوانی متفاوت داشت و به­عنوان ریسک فاکتور مرتبط با ناباروری مطرح است. در شکل 1 نمونه­هایی از ژنوتایپ­های هموزیگوت­های غالب CC و مغلوب AA و نمونه­های هتروزیگوت CA در کنار مارکر مولکولی bp 100 آورده شده است که حاصل هضم آنزیمی محصول PCR با انزیم Bstu I بوده­اند.

 

جدول 5- دموگرافی گروه بیمار و کنترل در این مطالعه

افراد مورد مطالعه

گروه بیمار ازو اسپرم

گروه بیمار اولیگواسپرم

گروه کنترل سالم

تعداد

77 نفر

19 نفر

100 نفر

گروه سنی

(57/4 ± 04/37 ) 45-37

(57/4 ± 04/37 ) 45-37

(31/5 ± 92/37 ) 45-26

تعداد اسپرم

صفر

کم­تر از 106×5

بیش­تر از106×20

حرکت اسپرم

فاقد حرکت

فاقد حرکت

بیش­تر از 50% متحرک

مورفولوژی اسپرم

نامعمول و غیر طبیعی

نامعمول و غیرطبیعی

بیش­تر از 30% طبیعی

شکل1- محصول­های هضم آنزیمی برای پلی‌مورفیسم rs737008 در ژن PRM1، خانه شماره 1: مارکر ژنتیکی bp 100، خانه شماره 2: نمونه uncut (محصول PCR فاقد برش آنزیمی) (bp 557)، خانه­های شماره 3 و4: نمونه­های هموزیگوت غالب برش یافته (CC) (bp 361 و bp 196)، خانه­های شماره 5 و 7: نمونه­های هتروزیگوت برش یافته (CA) (bp 557 و bp361 و bp 196) و خانه­های شماره 6 و 8: نمونه­های هموزیگوت موتان فاقد برش (AA) (bp 557).

 

نتایج آنالیز پلی‌مورفیسم­های rs737008 در ژن PRM1 و rs4780356 در ژن PRM2- با آنالیز آماری نتایج ژنوتایپینگ دو پلی‌مورفیسم مورد مطالعه و مقایسه بین داده‌های دو گروه بیمار و کنترل مشخص شد با این­که فراوانی آلل موتان A از پلی­مورفیسم rs737008 در ژن PRM1 در مقایسه بین گروه بیمار با گروه کنترل متفاوت بود ولی از نظر آماری اختلاف معنی­دار بین حضور این پلی­مورفیسم بین­گروه بیمار و کنترل وجود نداشت (05/0<P ).

هم­چنین فراوانی از حضور پلی­مورفیسم rs4780356 از ژن PRM2، در گروه بیمار و کنترل یافت نشد (05/0 <P ). بنابراین می­توان چنین نتیجه گرفت که بین حضور پلی‌مورفیسم­های rs737008 در ژن PRM1 و rs4780356 در ژن PRM2 با ایجاد ازواسپرمی و اولیگواسپرمی در ناباروری ادیوپاتیک مردان ایرانی از نظر آماری ارتباط معنی‌داری وجود ندارد (05/0<P ). نتایج فراوانی حضور این دو پلی­مورفیسم و آنالیز آماری آن بین گروه بیمار و کنترل در جدول 6 آورده شده است.

 

جدول 6- نتایج فراوانی ژنوتیپ‌های پلی‌مورفیسم rs737008 در ژن PRM1 و rs4780356 در ژن PRM2 و نتایج آنالیز آماری برای این دو پلی‌مورفیسم بین گروه بیمار و کنترل.

ژنوتایپ پلی مورفیسم rs737008

فراوانی گروه سالم

فراوانی گروه بیمار

آلل های پلی­مورفیسم

فراوانی آلل­ها در گروه سالم

فراوانی آلل­ها در گروه بیمار

P.value

هموزیگوت غالب (CC)

24

(24%)

22 (9/22%)

C

38

(38%)

 38 (6/39%)

 

هتروزیگوت (CA)

29

(29%)

32  (3/33%)

 

 

 

82/0

هموزیگوت مغلوب  (AA)

47

(47%)

42 (8/43%)

A

62

(62%)

  58

(4/60%)

 

فراوانی کل

 

100

(100%)

96 (100%)

 

100 (100%)

96 (100%)

 

ژنوتایپ پلی­مورفیسم rs4780356

فراوانی گروه سالم

فراوانی گروه بیمار

آلل­های پلی­مورفیسم

فراوانی آلل­ها در گروه سالم

فراوانی آلل­ها در گروه بیمار

P.value

هموزیگوت غالب (CC)

100

(100%)

96

(100%)

C

100

(100%)

96

(100%)

 

هتروزیگوت (CT)

0(0%)

0(0%)

 

 

 

NS*

هموزیگوت مغلوب  (CC)

0(0%)

0(0%)

T

0(0%)

0(0%)

 

فراوانی کل

100 (100%)

96 (100%)

 

100 (100%)

96 (100%)

 

NS* = به­دلیل فراوانی صفر برای آلل مغلوب T مقدار Pvalue به­صورت بدون معنی no significant محاسبه شده است.

 

 

نتایج تعیین توالی محصول­های PCR- نمونه­های محصول واکنش PCR برای دو ژن PRM1 و PRM2 تعیین توالی گردید و نتایج تعیین توالی در سایت بلاست NCBI یرای نمونه­های هموزیگوت غالب و مغلوب و هتروزیگوت کنترل شدند و با همولوژی که در سایت بلاست مشاهده شد نتایج ژنوتایپینگ با روش PCR-RFLP تأیید گردید.

بحث

براساس مطالعه­های انجام شده کم­تر از یک سوم دلایل ژنتیکی برای ناباروری هنوز ناشناخته هستند که به­نام دلایل ژنتیکی ادیوپاتیک نامیده شده‌اند. با وجود این­که فاکتورهای محیطی می‌توانند نقش مهمی در ناباروری مردان داشته باشند، مطالعه­های امروزه تغییرهای ژنتیکی را عامل مؤثری در این امر می­داند و به­خصوص توجه زیادی به­علل ژنتیکی در ناباروری ادیوپاتیک شده است (1،2،5،8). بر این اساس تحقیق حاضر به بررسی ارتباط حضور دو پلی‌مورفیسم rs737008 در ژن PRM1 و rs4780356 در ژن PRM2. و ایجاد ناباروری ادیوپاتیک در جمعیت مردان ایرانی پرداخته است. برای پلی­مورفیسم rs737008 در ژن PRM1 ، فراوانی آلل تغییر یافته A  در گروه بیمار 4/60% در مقایسه با گروه کنترل  62% بود که با توجه به آنالیز ریسک فاکتوری در این خصوص، این آلل می­تواند به­عنوان یک فاکتور مرتبط با ناباروری محسوب شود ولی محاسبه مقدار Pvalue برای آلل­های این پلی­مورفیسم نشان داد که در جمعیت مردان نابارور ایرانی اختلاف معنی­دار بین فراوانی حضور دو آلل غالب و موتانت در گروه بیمار و کنترل وجود ندارد و برای پلی­مورفیسم rs4780356 در ژن PRM2 ، فراوانی آلل وحشی C در گروه بیمار و کنترل 100% به­دست آمد و فراوانی آلل موتانت صفر بود. بنابراین آنالیز نتایج چنین نشان داد که بین فراوانی حضور پلی­مورفیسم‌های مطالعه شده در گروه بیمار و گروه کنترل تفاوت معنی‌دار وجود نداشته است و در نتیجه حضور این پلی­مورفیسم­ها درجمعیت مردان نابارور ایرانی با ایجاد ناباروری ادیوپاتیک در اثر اولیگواسپرمی و آزواسپرمی، مرتبط نیستند (زیرا مقدار Pvalue برای دو پلی­مورفیسم مورد مطالعه، بیش­تر از 05/0 و بدون ارتباط معنی­دار به­دست آمده است).

در ادامه برای نتیجه­گیری کلی به مقایسه نتایج تحقیق­های گذشته و پژوهش حاضر پرداخته شده است. بررسی مطالعه­های گذشته نشان می­دهد در سال­های اخیر تحقیق­های زیادی در مورد پلی‌مورفیسم و جهش‌ها در ژن­های پروتامین در جمعیت‌های مختلف انجام گرفته است و نتایج متفاوتی از این تحقیق­ها به­دست آمده است (9،10،12،13،14،15،16،17،18). تعدادی از این مطالعه­ها ارتباط معنی‌داری را بین پلی‌مورفیسم یا جهش­های مورد مطالعه در ژن پروتامین­ها گزارش نموده‌اند (15،16،17،19،20). از این تحقیقات می­توان به ارتباط پلی‌مورفیسم rs4780356 در ژن PRM2 با جمعیت مردان نابارور ژاپنی که معنی‌دار گزارش شده است و سبب ایجاد ازواسپرمی در آنان شده است اشاره نمود (11). هم­چنین تحقیقAl Zeyadi  و همکاران در سال 2019 نشان داده است که در جمعیت مردان شهر نجف پلی­مورفیسم rs4780356 در ژن PRM2 با ایجاد تتراتواسپرمیا و نورواسپرمیا و ناباروی ادیوپاتیک در مردان نابارور عراقی ارتباط معنی­دار داشته است (21). در تحقیق حاضر که به بررسی ارتباط بین پلی‌مورفیسم rs4780356 در ژن PRM2 با ناباروری مردان ایرانی پرداخته شده است، نتایج نشان داد که آن پلی­مورفیسم در هیچ­یک از نمونه­های گروه بیمار و کنترل یافت نشده و ارتباط معنی‌داری بین این پلی‌مورفیسم با ناباروری مردان ایرانی وجود ندارد. البته تکرار آزمایش­ها با تعداد نمونه بیش­تر برای اثبات نتایج توصیه می­گردد.

در خصوص پلی‌مورفیسم rs737008 در ژن PRM1 گزارش­هایی وجود دارد که بیان می­دارند بین این پلی­مورفیسم با ناباروری مردان ارتباط معنی‌داری وجود دارد (15،16،17،19). ولی در تعداد دیگری از مطالعه­ها، نتایجی مبنی­بر عدم ارتباط بین پلی­مورفیسم مذکور با ناباروری جمعیتی از مردان ژاپنی و ایرانی به­دست آمده است (11،22). در مطالعه حاضر نیز فراوانی پلی­مورفیسم rs737008 در ژن PRM1 بین جمعیت گروه مردان نابارور ایرانی و گروه کنترل تفاوت معنی­دار نشان نداده است (05/0 <P ) که در نتیجه نشان داده شده است که با ایجاد ناباوری در مردان ایرانی مرتبط نیست. علاوه­بر این موارد، در تعدادی دیگر از مطالعه­هایی که در خصوص پلی­مورفیسم­های معمول در ژن­های کدکننده پروتامین­ها انجام گرفته است ارتباطی بین پلی‌مورفیسم­های مورد مطالعه و ناباروری مردان مشاهده نشده است (10،16،18،22). در این رابطه می­توان به مطالعه Dehghanpour و همکاران در سال 2019 اشاره نمود که به بررسی 8 پلی­مورفیسم مختلف در ژن­های PRM1 و PRM2 در مردان نابارور ادیوپاتیک ایرانی پرداخته بودند. نتایج تحقیق آنان نشان داد فراوانی پلی­مورفیسم­های مختلف در این دو ژن بین گروه بیمار و کنترل تفاوت معنی­داری نداشتند ولی بیان نمودند فراوانی هتروزیگوتی برخی پلی­مورفیسم­ها بر کیفیت و مورفولوژی اسپرم و در نتیجه ایجاد اپوپتوز اسپرم می­توانند تأثیرگذار باشد (5). هم­چنین در تحقیق He و همکاران در سال 2019 که با روش متاانالیز برای بررسی ارتباط بین پلی­مورفیسم­های معمول در ژن­های پروتامین­ها و ناباروری مردان انجام گرفته بود، چنین گزارش شد که اکثر این پلی­مورفیسم­ها با ناباروری جمعیت مردان آسیایی ارتباط معنی­دار ندارند ولی می­توانند با ناباروری جمعیت مردان افریقایی- اروپایی مرتبط باشند (9). بر اساس این تحقیق­ها مشخص می­شود که فراوانی حضور پلی‌مورفیسم­ها در ژن­های PRM1 و PRM2 در جمعیت ایرانی و مقایسه آن­ها با سایر جمعیت­ها، نتایج متفاوتی را نشان می­دهد که ممکن است به­دلایل تفاوت مناطق جعرافیایی و آب و هوایی باشد که با شرایط محیط زیست و عادات زندگی این افراد ارتباط مستقیم دارد و یا به­دلیل تفاوت نژاد و قومیت­های مختلف که حاصل تفاوت ژنتیکی افراد است، باشد و یا به­دلیل تفاوت تعداد افراد مورد بررسی و تفاوت سنی آن­ها باشد که در هر حالت این موارد همگی می­توانند در نتایج تحقیق­ها اثرگذار باشند. هم­چنین ممکن است نوع تغذیه یا ابتلا به بیماری­های خاص و داروهایی که به­طور زمینه­ایی در بیماران مصرف شده، عاملی برای تفاوت نتایج در جمعیت­های مختلف مردان گردند. در هر صورت ناباروری یک بیماری کمپلکس به­شمار می­آید که می­تواند تفاوت فاکتورهای محیطی و تفاوت جغرافیایی و قومیتی (ژنتیکی) در جمعیت­های مختلف از نمونه­های مورد بررسی، اثرهای متفاوت پلی­مورفیسم­های ژن­های پروتامین را که در بیان ژن­های مرتبط با اسپرماتوژنز مؤثر هستند و نقش مهمی در ناباروری مردان دارند، را توجیه نماید. ذکر این نکته در انتها اهمیت دارد که با گستردگی مباحث در زمینه‌های ناباروری و تخصصی شدن هر یک از شاخه‌های مربوط به این دانش، ابداع روش­های جدید و شیوه‌های نوین در بررسی جهش­ها و پلی‌مورفیسم­ها را قابل تأمل نموده است زیرا به­کارگیری این متد‌ها می‌تواند راهگشایی برای مطالعه­های جامع‌تر در حوزه­های پیش آگهی، پیشگیری و درمان این بیماری عاطفی اجتماعی باشد و گامی مؤثر در جهت کاربرد روش­های فارماکوژنتیکی برای این بیماری محسوب گردد.

نتیجه ­گیری

ژن‌های پروتامین، ژن‌هایی اختصاصی و با ساختمان ویژه هستند که برای صحت روند اسپرماتوژنز ضروری‌اند و حضور پلی‌مورفیسم و جهش‌ها، وجود هاپلوتایپ­ها و لینک بودن برخی ژن­ها با این ژن­ها، می‌تواند در آسیب به اسپرماتوژنز و عدم تشکیل اسپرم سالم و بالغ مؤثر باشد و در نتیجه سبب ناباروری در جمعیت مردان گردد. گرچه با توجه­به نتایج این تحقیق این اثرها به­ندرت با ایجاد ناباروری مرتبط است ولی حضور این پلی‌مورفیسم‌ها و اثرهایی که آن­ها بر وقایع اپی­ژنتیک در روند تغییرها پس از ترجمه این ژن­ها اعمال می­نمایند، می­تواند به­عنوان عاملی در تخریب روند اسپرماتوژنز مطرح باشد. لذا مطالعه­های گسترده و با تعداد نمونه بیش­تر در جمعیت­های مختلف توصیه می­شود.

سپاسگزاری

از کلیه پرسنل و بیماران مرکز ناباروری نوید و مسئولان محترم پژوهشگاه ملی مهندسی ژنتیک که در انجام کارهای آزمایشگاهی این تحقیق کمال همکاری را مبذول فرموده­اند، تشکر و قدردانی به­عمل می­آید.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

منابع

1. Azizi F, Omrani M.D, Sadighi Gilani M.A, Hosseini J. The Genetic Causes of Male Infertility in Iranian Population; A systematic Review. Men’s Health Journal, 2018; 2 (1); e1. 

2. Venkatesh S, Kumar R, Deka D, Deecaraman M, Dada R. Analysis of sperm nuclear protein gene polymorphisms and DNA integrityin infertile men. Systems Biology in Reproductive Medicine, 2011; 57: 124–132.

3. Wang T, Gao H, Li W, Liu C. Essential Role of Histone Replacement and Modifications in Male Fertility. Frontiers in Genetics, 2019; 10(962): 1-15.

4. Park Sh. Genetic Factors and Environmental Factors Affecting Male Infertility. International Research J. Advanced Engineering and Science, 2016; 1(3): 115-118.

5. Dehghanpour F, Farzaneh Fesahat F, Miresmaeili S.M, Zare Mehrjardi E, Honarju A, Talebi A.L. Analysis of PRM1 and PRM2 Polymorphisms in Iranian Infertile Men with Idiopathic Teratozoospermia. International J. Fertility and Sterility, 2019; 13(1): 77-82.

6. Raheem A.A, Ralph D. Male infertility: causes and investigations. Trends in urology and mens health, 2011; 2(5): 8-11.

7. Bisht S, Mathur P, Dada R. Protamines and their role in pathogenesis of male infertility. Transl Cancer Res, 2016; 5(3):324-326.

8. Tavalaee M, Ghorbani R, Nasr-Esfahani MH. The Role of Sperm Protamine in Pathogenesis of Male Infertility. J. Fasa University of Medical Sciences, 2019; 9 (2): 1357-1367.

9. He Q, Deng L, Deng S, Jin T. Association of protamine1 gene c.-190C>A polymorphism with male infertility risk: a meta-analysis. Int J Clin Exp Med, 2019; 12(4):3047-3055.

10. Nabi1 A, Khalili M.A, Moshrefi M, Sheikhha M.H, Zare Mehrjardi E, Ashrafzadeh H.R. Polymorphisms in protamine 1 and 2 genes in asthenozoospermic men: A case-control study. Int J Reprod BioMed, 2018; 16(6): 379-386.

11. Tanaka H, Miyagawa Y, Tsujimura A, Matsumiya K, Okuyama A.Y.N. Single-nucleotide polymorphisms in the protamine-1 and -2 genes of fertile and infertile human male populations. Molecular Human Reproduction, 2003; 9: 69-73.

12. Gazouez C, Oriola J, De Mateo S, Vidal-Taboada J.M, Ballesca J.I. A comman protamine 1 promoter polymorphism (C190A) correlates with abnormal sperm morphology and increased protamine P1/P2 ratio in infertile patients. J. Andrology, 2008; 29: 540-548.

13. Iguchi N, Yang S, Lamb D.J. An SNP in protamine 1: a possible genetic cause of male infertility? J Med Genet, 2006; 43: 382-384.

14. Imken L, Rouba H, EI Houate B, Louanjli N, Barakat A, Chafik A.  Mutations in the protamine locus: association with spermatogenic failure? Molecular Human Reproduction, 2009; 7: 1-22.

15. Jiang W, Shi L,  Liu H, Cao J,  Zhu P, Yu M, Guo Y, Cui Y, Xia X. Systematic review and metaanalysis of the genetic association between protamine polymorphism and male infertility. Andrologia, 2018; 50(5): e12990.

16. Jiang W, Sun H, Zhang J, Zhou Q, Wu Q, Li T, i Zhang C, Li W, Zhang M, Xia X. Polymorphisms in Protamine 1 and Protamine 2 predict the risk of male infertility: a meta-analysis. Scientific Reports, 2015; 5(15300): 1-11.

17. Jiang W, Zhu P, Zhang J, Wu Q, Li W, Liu S, Ni M, Yu M, Cao J, Li Y, Cui Y, Xia X. Polymorphisms of protamine genes contribute to male infertility susceptibility in the Chinese Han population. Oncotarget, 2017; 8(37): 61637-61645.

18. Jodar M, Oriola J, Mestre G, Castillo J, Giwercman A, VidalTaboada J. Polymorphisms, haplotypes and mutations in the protamine 1 and 2 genes. Int J Androl, 2011; 34: 470-485.

 19. Aydos O.S.E,  Hekmatshoar Y, Altınok B, Özkan T, Şakirağaoğlu O, Karadağ A,  Kaplan F, Ilgaz S,  Taşpınar M, Yükselen I, Sunguroğlu A,  Aydos K. Genetic Polymorphisms in PRM1, PRM2, and YBX2 Genes are Associated with Male Factor Infertility. Genet Test Mol Biomarkers2018; 22(1):55-61.

20. Tüttelmann F, Křenková P, Römer S, Nestorovic A.R, Ljujic M, Štambergová A. A common haplotype of protamine 1 and 2 genes is associated with higher sperm counts. Int J Androl, 2010; 33: e240-e280.

21. Al Zeyadi M, AL-Salimi A.S.M, Albaldawy M.T. Single Nucleotide Polymorphism in Protamine 1 and Protamine 2 genes in fertile and infertile for men of Al-Najaf City. J. Phys.: Conf. Ser, 2019; 1234 (012081): 1-10.

22. Salamian A, Ghaedi K, Razavi S, Tavalaee M, Tanhael S, Tavalaee M, Salahshouri I, Gourabi H.M.H. Single nucleotide polymorphism analysis of protamine genes in infertile men. Royan Institute International Journal of Fertility and Sterility, 2008;  2(1): 13-18.

23. Aston K.I, Krausz C, Laface I, Ruiz-Castane E, Carrell D.T. Evaluation of 172 candidate polymorphisms for association with oligozoospermia or azoospermia in a large cohort of men of European descent. Hum Reprod, 2010; 25: 1383-1397.


[1]- Male infertility

نوع مطالعه: مقاله پژوهشی | موضوع مقاله: سلولی و مولکولی
دریافت: 1399/7/27 | پذیرش: 1399/6/10 | انتشار: 1399/6/10

فهرست منابع
1. Azizi F, Omrani M.D, Sadighi Gilani M.A, Hosseini J. The Genetic Causes of Male Infertility in Iranian Population; A systematic Review. Men’s Health Journal, 2018; 2 (1); e1.
2. Venkatesh S, Kumar R, Deka D, Deecaraman M, Dada R. Analysis of sperm nuclear protein gene polymorphisms and DNA integrityin infertile men. Systems Biology in Reproductive Medicine, 2011; 57: 124–132.
3. Wang T, Gao H, Li W, Liu C. Essential Role of Histone Replacement and Modifications in Male Fertility. Frontiers in Genetics, 2019; 10(962): 1-15.
4. Park Sh. Genetic Factors and Environmental Factors Affecting Male Infertility. International Research Journal of Advanced Engineering and Science, 2016; 1(3): 115-118.
5. Dehghanpour F, Farzaneh Fesahat F, Miresmaeili S.M, Zare Mehrjardi E, Honarju A, Talebi A.L. Analysis of PRM1 and PRM2 Polymorphisms in Iranian Infertile Men with Idiopathic Teratozoospermia. International Journal of Fertility and Sterility, 2019; 13(1): 77-82.
6. Raheem A.A, Ralph D. Male infertility: causes and investigations. Trends in urology and mens health, 2011; 2(5): 8-11.
7. Bisht S, Mathur P, Dada R. Protamines and their role in pathogenesis of male infertility. Transl Cancer Res, 2016; 5(3):324-326.
8. Tavalaee M, Ghorbani R, Nasr-Esfahani MH. The Role of Sperm Protamine in Pathogenesis of Male Infertility. Journal of Fasa University of Medical Sciences, 2019; 9 (2): 1357-1367.
9. He Q, Deng L, Deng S, Jin T. Association of protamine1 gene c.-190C>A polymorphism with male infertility risk: a meta-analysis. Int J Clin Exp Med, 2019; 12(4):3047-3055.
10. Nabi1 A, Khalili M.A, Moshrefi M, Sheikhha M.H, Zare Mehrjardi E, Ashrafzadeh H.R. Polymorphisms in protamine 1 and 2 genes in asthenozoospermic men: A case-control study. Int J Reprod BioMed, 2018; 16(6): 379-386.
11. Tanaka H, Miyagawa Y, Tsujimura A, Matsumiya K, Okuyama A.Y.N. Single-nucleotide polymorphisms in the protamine-1 and -2 genes of fertile and infertile human male populations. Molecular Human Reproduction, 2003; 9: 69-73.
12. Gazouez C, Oriola J, De Mateo S, Vidal-Taboada J.M, Ballesca J.I. A comman protamine 1 promoter polymorphism (C190A) correlates with abnormal sperm morphology and increased protamine P1/P2 ratio in infertile patients. Journal of Andrology, 2008; 29: 540-548.
13. Iguchi N, Yang S, Lamb D.J. An SNP in protamine 1: a possible genetic cause of male infertility? J Med Genet, 2006; 43: 382-384.
14. Imken L, Rouba H, EI Houate B, Louanjli N, Barakat A, Chafik A. Mutations in the protamine locus: association with spermatogenic failure? Molecular Human Reproduction, 2009; 7: 1-22.
15. Jiang W, Shi L, Liu H, Cao J, Zhu P, Yu M, Guo Y, Cui Y, Xia X. Systematic review and meta‐analysis of the genetic association between protamine polymorphism and male infertility. Andrologia, 2018; 50(5): e12990.
16. Jiang W, Sun H, Zhang J, Zhou Q, Wu Q, Li T, i Zhang C, Li W, Zhang M, Xia X. Polymorphisms in Protamine 1 and Protamine 2 predict the risk of male infertility: a meta-analysis. Scientific Reports, 2015; 5(15300): 1-11.
17. Jiang W, Zhu P, Zhang J, Wu Q, Li W, Liu S, Ni M, Yu M, Cao J, Li Y, Cui Y, Xia X. Polymorphisms of protamine genes contribute to male infertility susceptibility in the Chinese Han population. Oncotarget, 2017; 8(37): 61637-61645.
18. Jodar M, Oriola J, Mestre G, Castillo J, Giwercman A, Vidal‐Taboada J. Polymorphisms, haplotypes and mutations in the protamine 1 and 2 genes. Int J Androl, 2011; 34: 470-485.
19. Aydos O.S.E, Hekmatshoar Y, Altınok B, Özkan T, Şakirağaoğlu O, Karadağ A, Kaplan F, Ilgaz S, Taşpınar M, Yükselen I, Sunguroğlu A, Aydos K. Genetic Polymorphisms in PRM1, PRM2, and YBX2 Genes are Associated with Male Factor Infertility. Genet Test Mol Biomarkers, 2018; 22(1):55-61.
20. Tüttelmann F, Křenková P, Römer S, Nestorovic A.R, Ljujic M, Štambergová A. A common haplotype of protamine 1 and 2 genes is associated with higher sperm counts. Int J Androl, 2010; 33: e240-e280.
21. Al Zeyadi M, AL-Salimi A.S.M, Albaldawy M.T. Single Nucleotide Polymorphism in Protamine 1 and Protamine 2 genes in fertile and infertile for men of Al-Najaf City. J. Phys.: Conf. Ser, 2019; 1234 (012081): 1-10.
22. Salamian A, Ghaedi K, Razavi S, Tavalaee M, Tanhael S, Tavalaee M, Salahshouri I, Gourabi H.M.H. Single nucleotide polymorphism analysis of protamine genes in infertile men. Royan Institute International Journal of Fertility and Sterility, 2008; 2(1): 13-18.
23. Aston K.I, Krausz C, Laface I, Ruiz-Castane E, Carrell D.T. Evaluation of 172 candidate polymorphisms for association with oligozoospermia or azoospermia in a large cohort of men of European descent. Hum Reprod, 2010; 25: 1383-1397.

ارسال نظر درباره این مقاله : نام کاربری یا پست الکترونیک شما:
CAPTCHA

بازنشر اطلاعات
Creative Commons License این مقاله تحت شرایط Creative Commons Attribution-NonCommercial 4.0 International License قابل بازنشر است.

کلیه حقوق این وب سایت متعلق به مجله تازه های بیوتکنولوژی سلولی - مولکولی می باشد.

طراحی و برنامه نویسی : یکتاوب افزار شرق

© 2022 CC BY-NC 4.0 | New Cellular and Molecular Biotechnology Journal

Designed & Developed by : Yektaweb