Volume 9, Issue 36 (9-2019)  

View This Issue in Alternative Language Export Journal XML Articles RSS
Abstract (1262 Views) | چکیده  |   Full-Text (PDF) (263 Downloads)   |   Highlights
Production of silver Nano particle by mesophilic aerobic bacteria isolated from Persian Gulf
 
Marzieh Khodaverdi Tajabadi 1, Babak Kheyrkhah 2*, Kumarss Amini 3
1 Department of Microbiology, School of Basic Sciences, Kerman Branch, Islamic Azad University, Kerman, Iran.
2 Assistant Professor, Department of Microbiology, School of Basic Sciences, Kerman Branch, Islamic Azad University, Kerman, Iran.
3 Associate Professor, Department of Microbiology, School of Basic Sciences, Saveh Branch, Islamic Azad University, Saveh, Iran.
*Corresponding author: Dr. Babak Kheyrkhah, Department of Microbiology, Kerman Branch, Islamic Azad University, Kerman, Iran.
E-mail: babakkheirkhah@yahoo.com
                                    
Abstract
Aim and Background: Nanoparticles are widely used in medical, pharmaceutical and health sciences. The aim of this project was to evaluate the mesophilic bacteria isolated from the Gulf coast in the production of silver nanoparticles and investigate the antimicrobial effect of these nanoparticles on some pathogenic bacteria.
Material and methods: This descriptive and cross-sectional study was performed over a period of 8-month from April to November 2017. The isolates were purified from water and sediments samples of the coasts of Hormozgan Province - Iran, after that the purified isolates were cultivated in Zobell Marine Broth medium. The obtained supernatant of the medium was added to the silver nitrate (AgNO3) solution (0/001 M) with (1:5) ratio at the light condition in order to the reduction of AgNO3 to metallic silver. The synthesis of silver nanoparticles (AgNPs) was investigated by UV-Vis spectrophotometer, Transmission electron microscope(TEM), and Fourier transform infrared (FTIR) spectroscopy analysis. The antimicrobial activity of AgNPs was evaluated against 6 microbes.
Results: The results indicated that supernatants of all isolates are capable of producing silver nanoparticles. The surface plasmon resonance of AgNPs showed a maximum peak near 420 nm, which UV–vis spectra correspond to the absorbance of AgNPs. The results of TEM micrographs image of silver nanoparticles produced by dominant strain showed spherical shapes and size of 2/88 to 19 nm. The synthesized AgNPs showed the antimicrobial activity and inhibitory effects on the growth of tested microbes. 
Conclusion: The desired isolates have a potential ability to producing AgNPs, and to summarize, this is a low cost, ecofriendly, and quick method for the synthesis of AgNPs.
Keywords: Aerobic mesophilic bacteria, Persian Gulf, silver nanoparticles.
 
تولید نانوذره­های نقره توسط باکتری­های هوازی مزوفیل جداسازی شده از آب­های خلیج فارس
مرضیه خداوردی تاج­آبادی 1، بابک خیرخواه 2*، کیومرث امینی 3
1 دانش­آموخته کارشناسی­ ارشد، گروه میکروبیولوژی، دانشکده علوم پایه، واحد کرمان، دانشگاه آزاد اسلامی، کرمان، ایران.
2 استادیار، گروه میکروبیولوژی، دانشکده علوم پایه، واحد کرمان، دانشگاه آزاد اسلامی، کرمان، ایران.
3 استادیار، گروه میکروبیولوژی، دانشکده علوم پایه، واحد ساوه، دانشگاه آزاد اسلامی، ساوه، ایران.
* مولف مسئول: دکتر بابک خیرخواه-  گروه میکروبیولوژی، دانشگاه آزاد اسلامی واحد کرمان.
ایمیل نویسنده مسئول : babakkheirkhah@yahoo.com
 
 
چکیده
سابقه و هدف: نانوذره­ها کاربرد وسیعی در علوم پزشکی و دارویی و بهداشتی دارند. هدف از انجام پروژه حاضر، ارزیابی باکتری­های مزوفیل جداسازی شده از سواحل خلیج‌فارس در تولید نانوذره­ها­ی نقره و بررسی اثر ضد میکروبی این نانوذره­ها بر روی برخی از باکتری‌های پاتوژن می‌باشد.
مواد و روش­ها: این مطالعه توصیفی-مقطعی در یک بازه زمانی8 ماهه از اردیبهشت لغایت آذر 1396انجام شد. پس ازخالص سازی جدایه ها از آب و رسوب ها ازسواحل استان هرمزگان و کشت در محیط زوبل مارین براث، سوپر ناتانت حاصل در شرایط نوری به نسبت 1به5 بامحلول نیترات نقره 001/0مولاربه جهت احیای فلزی تیمارشد.وجود نانو ذره های نقره از طریق اسپکتروفتومتر،میکروسکوپ الکترونی TEM،آنالیز FTIR وخواص ضد میکروبی ،نانو ذره ها علیه 6 میکروب مورد بررسی قرار گرفت.
یافته ها:سوپر ناتانت کلیه جدایه ها توانایی تولید نانو ذره های نقره را دارد .در اسپکتروفتومتر نقطه اوج 420 نانو متر، مربوط به رزونانس پلاسمون سطحی نانو ذره های نقره است ونتایج FTIR وجود ترکیبات احتمالی، دخیل در تولید نانو ذره ها را اثبات کرد.تصاویر میکروسکوپ الکترونیTEM نانو ذره های تولیدی توسط سویه برتر را کروی شکل با ابعاد19-88/2نانومتر نشان داد وخواص ضد میکروبی با توانایی مهار، رشد میکروب ها توسط نانو ذره های تولیدی مشخص شد.
نتیجه گیری:جدایه های مورد نظر توان تولید نانو ذره های نقره  را دارند واین روش تولید برای محیط زیست ایمن،واز نظر اقتصادی وزمان به صرفه است.
واژه­های کلیدی: باکتری مزوفیل هوازی، خلیج‌فارس، نانوذره های نقره
مقدمه
امروزه علم نانو یا نانو فناوری به‌سرعت در حال رشد می­باشد و فناوری نانو درمجموع توصیف فناوری و علم مربوط به نانوذره­ها است و افزایش دامنه تحقیق­ها و تنظیم فعل ‌و انفعال­ها در سطح سلولی بین مواد مصنوعی و سیستم­های بیولوژیک را در پی دارد. از نانوذره­ها می­توان به‌عنوان یک ابزار کارآمد برای کشف بر ترین فرآیندها در پروسه­ی بیولوژیکی و علوم پزشکی استفاده کرد (1). تولید نانوذره­های نقره یک دستاورد شگرف علمی از علم نانوتکنولوژی است که در عرصه­های مختلف علوم پزشکی و صنایع مختلف مثل کشاورزی، دامپروری، آرایشی و بهداشتی کاربرد دارد (2). امروزه سنتز نانوذره­های فلزی به­خصوص نانوذره ­های نقره به­دلیل اهمیت زیستی و کاربردهای پزشکی بسیار موردتوجه قرارگرفته‌اند. به‌طورکلی سه روش شیمیایی، فیزیکی و بیولوژیکی به‌منظور سنتز این نانوذره­های نقره به­کار می­رود؛ در روش­های فیزیکی و شیمیایی علاوه بر تحمیل هزینه‌های بالا، آلودگی­های زیست‌محیطی بسیاری را به همراه دارند (3، 4). تولید نانوذره­های نقره توسط روش­های زیستی علاوه بر ارزان بودن وعدم نیازبه تجهیزهای گران ‌قیمت و به‌کارگیری روش­های آسان و در نظر گرفتن این نکته که ازلحاظ پایداری نسبت به روش­های شیمیایی و فیزیکی از پایداری بالاتری برخوردار خواهند بود، به‌مرور جایگزین روش­های فوق خواهند شد ( 5). از طرفی توسعه مقاومت­های آنتی‌بیوتیکی علیه میکروارگانیسم­ها به یک مشکل تبدیل‌شد­ه ­است و با توجه به این­که حدود 70 درصد از اکوسیستم­های کره زمین را آب­ها پوشانده‌اند و دارای تنوع عظیم میکروبی هستند؛ میکروارگانیسم­های آب‌شور کم­تر موردتوجه قرارگرفته‌اند (6). در سال­های اخیر جستجو برای منابع بالقوه از تحمل فلزی میکروارگانیسم­ها ،قارچ­ها، سیانو باکتری­ها و جلبک­های آب‌شور برای سنتز نانوذره­های فلزی کم تر بوده است. در این روش از گیاهان و میکروارگانیسم­هایی مانند باکتری­ها، قارچ­ها، مخمرها و اکتینومیست­ها جهت تولید نانوذره­ها استفاده می‌شود. هنگامی‌که میکروارگانیسم­ها در معرض نمک­های فلزی قرار می­گیرند ، با استفاده از آنزیم های خاص مانند: NADH ردوکتاز و یا نیترات ردوکتاز یون های فلزی را احیا و نانو ذره ها رابه‌ صورت داخل سلولی و یا خارج سلولی تولید می­کنند (7). باکتری­ها در مقایسه با قارچ­ها به دلیل کاربرد آسان‌تر موردتوجه گرفته‌اند. از تشکیل مواد بیولوژیکی معدنی توسط باکتری­ها به تازگی گزارش­هایی ارائه گردیده­است ازجمله : تشکیل نانوکریستال­های لانتیوم توسط باکتری سودوموناس آنروژِینوزا و اشرشیا کلی در محیط حاوی نیترات لانتیوم است. میزان مقاومت باکتری به یون­های فلزی و تشکیل ذره­های معدنی به ترکیب­های محیط رشد و ظرفیت جذب سلول­ها برای جذب یون­های فلزی سنگین وابسته است. تیوباسیلوس فرواکسیدانس و تیوباسیلوس تیواکسیدانس قادر به فروشویی سولفیدهای معدنی و تولید نانوذره­های نقره است. یکی از مثال­های باکتری­های تجمع دهنده­ی فلزات، سودوموناس استاتزری است که قادر به تولید نانوذره­های نقره کم­تر از 400 نانومتراست. با توجه به خاصیت ضدمیکروبی نقره بایستی مکانیسم­هایی در باکتری سودوموناس استاتزری وجود داشته­باشد که سبب مقاومت این باکتری به نقره است (8، 9، 10، 11). با توجه به این‌که بیوتکنولوژی میکروبی دریا راه نوینی برای پیدا کردن میکروارگانیسم­های جدید جهت استفاده از پتانسیل­های بالقوه آن­ها محسوب می­شود؛ آب­های شور می­توانند منبع خوبی برای تحمل فلزی میکروارگانیسم­ها باشد (12). از نانوذره­های نقره می‌توان به‌عنوان دارو در درمان بیماری­های پوستی مانند جوش، انواع جراحت­ها، سوختگی­ها، بیماری­های باکتریایی، بیماری­های قارچی، بیماری­های گوارشی، بیماری­های عفونی و بیماری­های جنسی استفاده کرد. در مواد دندانی، نانوذره­های نقره با قطر ذره­های اولیه کوچک­­تر از 40 نانومتر به‌عنوان یک ضد باکتری در طول فرآیند پلی­مریزاسیون استفاده می‌شوند (13). نانوذره های نقره بااتصال به گلیکوپروتئین 120 کیلودالتونی که در سطح ویروس ایدز قرار دارد مانع از چسبیدن ویروس ایدز به سلول­های زنده می­شود. دانشمندان در حال حاضر مشغول ساختن ماده­ای با استفاده از این نانوذره­ها برای پیشگیری از ایدز هستند (14 و 15). در ایران تولید نانوذره­های نقره با استفاده از میکروب­های آب‌شور موردبررسی قرار نگرفته لذا لزوم توجه به پتانسیل باکتری­های مزوفیل جداسازی شده خلیج‌فارس احساس شده و در پژوهش حاضر این پتانسیل در مقیاس آزمایشگاهی بررسی گردید؛ لذا در این مطالعه به جداسازی باکتری­های مزوفیل هوازی دارای توانمندی تولید نانو­ذره­های نقره از آب­های شور خلیج‌فارس پرداخته شد و سویه­های برتر شناسایی و معرفی گردیدند.
روش کار
نمونه­برداری از آب دریا و جداسازی باکتری‌ها
در این مطالعه­ی توصیفی-مقطعی که در یک بازه زمانی 8 ماهه از ابتدای اردیبهشت لغایت انتهای آذر 1396 انجام گردید، نمونه آب و رسوب­ها از سواحل و مناطق مختلف خلیج‌فارس ازجمله ساحل بندرلنگه، ساحل شهر بندرعباس، ساحل میشین، جزیره قشم و جزیره هرمز در بطری­های استریل درب پیچ­دار جمع‌آوری شد و با رعایت شرایط سرمایی 5-2 درجه سانتی گراد در جعبه یخ به آزمایشگاه منتقل گردید. در آزمایشگاه، از کلیه­ی نمونه­ها در شرایط استریل رقت­های سریالی در محلول رینگر (شرکت فرآورده هایی تزریقی ودارویی-ایران )تهیه شد و از رقت های تهیه‌شده در شرایط استریل مقدار 2/0 میلی­لیتر در سطح محیط کشت پلیت کانت آگار (مرک-آلمان )ریخته شد و کشت سطحی انجام شد و محیط های کشت به مدت 48 ساعت در دمای 30 درجه سانتی گراد گرم­خانه گذاری شدند (انکوباتور مدل بهداد-ایران )و سپس ازلحاظ رشد و عدم رشد مورد پایش قرار گرفتند. براساس خصوصیت­های ظاهری، باکتری­های رشد کرده انتخاب و در سطح محیط­های کشت پلیت کانت آگار به‌صورت خطی برای گرفتن کلنی خالص کشت داده شد و پس‌ازآن در دمای 30 درجه سانتی گراد به مدت 48-24 ساعت گرم خانه گذاری شدند و ازلحاظ خلوص موردبررسی قرار گرفتند. به‌منظور اطمینان از جداسازی میکروارگانیسم­ها با منبع دریایی علاوه بر محیط پلیت کانت آگار از محیط اختصاصی زوبل مارین­آگار (هیمدیا-هند)و زوبل­مارین­براث (هیمدیا-هند)نیز استفاده شد.
 
بررسی توانایی تولید نانوذره­های نقره توسط جدایه­ها
از کلیه جدایه­های به‌دست‌آمده با منبع دریایی و چند جدایه که منبع دریایی نداشتند که در مرحله­ی غربال­گری خالص­سازی و از آن­ها کشت جوان تهیه‌شده بود. سوسپانسیون باکتریایی معادل نیم مک فارلند تهیه و به مقدار 1 میلی لیتر به محیط کشت تلفیقی نوترینت­براث(مرک-آلمان) و زوبل مارین براث که به آن 7 درصد آب و رسوب های دریا اضافه شده بود، تلقیح شد. کلیه­ی محیط­ها در دمای30  درجه سانتی گراد به مدت 48 ساعت در انکوباتور شیکردار(مدل بهداد-ایران)، دور  rpm150 قرار داده شدند و سپس از سوپرناتانت )روماند) و بیومس )توده زیستی( رشد کرده برای تولید نانوذره­های نقره به دو روش عمل شد. درروش اول بعد از سانتریفیوژ(مدل بهداد-ایران) محیط کشت در شرایط استریل در دور rpm 5000 به مدت 20 دقیقه روماند حاصل جداسازی و به نسبت 1 به 5 به محلول نیترات نقره 001/0 مولار(فلوکا-فرانسه) تلقیح و در شرایط نوری قرار داده‌شد و ازلحاظ تولید نانوذره­ها مورد پایش قرار گرفتند. درروش دوم از توده­ی زیستی به‌دست‌آمده از محیط کشت بعد از سانتریفیوژ به نسبت 1به 5 به محلول نیترات نقره 001/0 مولار افزوده شد و نمونه در شرایط تاریکی )فویل آلومینیومی) به مدت 48 ساعت و روشنایی در عرض چند ثانیه نگهداری و ازلحاظ تولید نانوذره­ها نقره مورد پایش قرار گرفتند. محلول­هایی که دارای رنگ خرمایی بودند می­توانند حاوی نانوذره­های نقره باشند که برای ادامه کار و اثبات نانوذره­ها نقره از روش­های دستگاهی استفاده شد. از کلیه نانوذره­های نقره تولیدی در پروژه حاضر ارزیابی­های حساسیت ضد میکروبی به روش رقت­سازی در مایع[1] صورت گرفت. در تمام مراحل این واکنش از سویه باسیلوس سرئوس ATCC 25922 به عنوان سویه­ای ناتوان در تولید نانوذره استفاده شد.لازم به ذکر است که میکرو ارگانیسم ها با احیایونهای نقره از نمک های نقره به فرم اتمی سبب بقا خود میشوند.
اندازه گیری جذب نوری محلول های حاوی نانو ذره های نقره توسط دستگاه اسپکتروفتومترUV-VIS
اندازه گیری جذب نوری محلول ها بعد از گذشت 2 ساعت از زمان  واکنش روماند جدایه ها با نیترات نقره به تفکیک در طول موج های 500-250نانو متر توسط دستگاه اسپکتروفتومتر(فتونیکسAR.2015-ایران)انجام ونتایج یادداشت شد.
روش طیف‌سنجی تبدیل فوریه مادون‌قرمز[2] (FTIR)
 این آنالیز برای محلول­های حاوی نانوذرات نقره تولیدی که دارای پایداری بالا و رنگ خرمایی و خواص ضد میکروبی مطلوب­تری انجام شد. این روش به شناسایی تعاملات بین نمک نقره وپروتئین وسایر ترکیبات احتمالی دخیل در تولید نانوذره های نقره کمک می کند.در این آزمون 4 نمونه انتخاب و در دستگاه FTIR مدل تنسور 27 مورد آنالیز دستگاهی قرار گرفتند.
 
تصویربرداری میکروسکوپ الکترونی گذاره (TEM [3])
برای اثبات وجود نانوذره­های نقره و همچنین تعیین اندازه، شکل، آرایش و پوشش پروتئینی اطراف آن­ها از بین کلیه­ی نانوذره­های نقره تولیدی فقط یک نمونه که خواص ضد میکروبی مطلوب‌تری داشت و در آنالیزهای دستگاهی اولیه اثبات شده بودند و برای تصویربرداری توسط TEM به آزمایشگاه ارسال گردیدند. ابتدا محلول توسط پنبه و قیف (برای تفکیک به تر و تراکم کم تر) صاف و سپس محلول به مدت 15 دقیقه سونیکیت شد و سپس یک قطره از نمونه بر روی صفحه­های مسی پوشیده شده با کربن قرار داده شد تا لایه‌نازکی از نمونه حاصل شود و با استفاده از دستمال­های مخصوص نمونه اضافی برداشته شد و این نمونه با TEM تصویربرداری گردید.
شناسایی باکتری تولیدکننده­ی نانوذره­های نقره به روش مولکولی
علاوه بر مشاهده­های مورفولوژیکی و انجام آزمایش های  بیوشیمیایی از روش تعیین توالی ژن 16SrRNA نیز جهت اثبات جنس باکتری موردنظر استفاده شد. استخراج DNA با استفاده از کیت شرکت سیناژن (مدل: EX6071) انجام شد. پس از انتخاب پرایمرهای مناسب و بلاست [4] نمودن آن‌ها در سایت NCBI، واکنش PCR به حجم نهایی 25 میکرو لیتر شامل 5/12 میکرو لیتر PCR master mix 5X (سینا کلون، ایران) حاوی (U/μl05/0) Taq DNA polymerase ،(Mm3) MgCl2 و (Mm4/0) dNTPs ، 8/ 0 میکرو لیتر از هر یک از پرایمرها به غلظت 8/0 میکرومولار، 1 میکرو لیتر از DNA الگو (10 نانوگرم) و 3/8 میکرو لیتر آب دو بار تقطیر استریل با استفاده از گرادیانت ترموسایکلر (اپندورف، آلمان) برای 30 سیکل به‌صورت زیر انجام گرفت؛ با انتخاب برنامه مرتبط به‌صورت ذیل عمل گردید: گام اول واسرشت ثانویه 94 درجه سانتی گراد 50 ثانیه، گام دوم اتصال آغازگر 55 درجه برای 45 ثانیه، گام سوم بسط اولیه 72 درجه سانتی گراد برای 2 دقیقه و یک بسط نهایی 72 درجه برای 10 دقیقه در نظر گرفته شد. در پایان، محصول های واکنش PCR در ژل آگارز 1% حاوی اتیدیوم بروماید (µg/ml 0.5) الکتروفورز گردید. هم‌چنین محصول­های PCR با استفاده از روش سانگر و توسط شرکت ژن فن اوران تعیین توالی گردید.
جدول 1- توالی الیگونوکلئوتیدی پرایمرهای استفاده شده در مطالعه پیش رو
توالی الیگونوکلئوتیدی ('3'5) قطعه مورد نظر
F:AGAGTTTGATCCTGG CTCAG
R:CGGTTACCTTGTTACGACTT
16SrRNA
 
 
رسم درخت فیلوژنتیک
بعد از توالی یابی و شناسایی جدایه‌ها، درخت فیلوژنتیک برای سویه‌های برتر رسم شد (تصویر 3). هم‌ردیفی توالی ژن 16SrRNA نمونه‌ها به همراه تعدادی از گونه‌های جنس مارینوباکتر به روش ماسل [5] در برنامه مگا 6[6] انجام گرفت و سپس ارتباط تبارشناسی سویه‌ها با روش الحاق همسایگی مشخص شد. هم‌چنین درخت تبار شناختی رسم شده، توسط گونه‌ی سراشیا اودوریفرا سویه XY21 به عنوان گروه خارجی[7] ، ریشه‌دار گردید.
تعیین کم­ترین غلظت مهاری نانوذره­ها بر برخی از باکتری­های پاتوژن
در این مطالعه سویه­های اشرشیا کلی ATCC 25922، سودوموناس آئروژینوزا ATCC 27853، استافیلوکوکوس اورئوس ATCC 25922، باسیلوس سرئوس ATCC 21772 و انتروکوکوس فکالیس ATCC 29212وکاندیدا آلبیکنز ATCC1778 از بانک میکروبی دانشگاه علوم پزشکی ایران تهیه شدند. سویه­های موردمطالعه با استفاده از محیط­های افتراقی، انتخابی و اختصاصی و با استفاده از تست­های بیوشیمیایی تائید هویت گردیدند. آزمون تعیین حساسیت آنتی­بیوتیکی به‌منظور تعیین کم­ترین غلظت مهاری (MIC) با استفاده از روش رقت­سازی لوله­ای و بر اساس دستورالعمل مؤسسه استانداردهای آزمایشگاهی و بالینی (CLSI) انجام گردید.  به‌طور خلاصه، ابتدا محلول ذخیره با غلظت 1024 میلی‌گرم در میلی‌لیتر از نانوذره تهیه و سپس، رقت‌های سریالی با طیف 1 تا 512 میلی‌گرم در میلی‌لیتر در لوله‌های مولر هینتون براث (مرک- آلمان) فراهم گردید. عمل تلقیح سوسپانسیون میکروبی با کدورت نیم مک فارلند به لوله‌های براث حاوی نانوذره انجام شد. پس از 24 ساعت نگه داری در دمای 37 درجه سانتی گراد انکوباتور، اولین لوله‌ای که فاقد کدورت قابل‌مشاهده بود، به عنوان MIC تعیین و ثبت گردید.
یافته­ها
کشت نمونه­ها
در محیط پلیت کانت آگار (مرک- آلمان) درمجموع در مرحله غربال گری اولیه 39 و در محیط کشت زوبل مارین آگار (هیمدیا-هند) 16جدایه باکتریایی جداسازی و خالص شدند. انواع کلنی ازنظر شکل، رنگ و نوع از نمونه­های مختلف جدا شد. در محیط کشت تهیه‌شده بر پایه آب دریا نیز 27 جدایه باکتری جدا گردید.
 
 ارزیابی نمونه­های با منبع دریایی و غیردریایی برای تولید نانوذره های نقره
 نتایج ارزیابی تولید نانوذره­های نقره توسط روماند و بیومس از جدایه­ها با منبع دریایی و غیردریایی به شرح جدول 2 و 3 می­باشد.
 
نتایج ارزیابی تولید نانوذره­های نقره با دستگاه اسپکتروفتومتر
برای اطمینان از تولید نانوذره­های نقره در نمونه­های موردنظر، جذب نوری محلول­های به‌دست‌آمده در طول‌موج‌های مختلف اندازه‌گیری شد که در جدول 4 آمده است. بدون در نظر گرفتن نمونه بیش ترین جذب نوری مربوط به طول‌موج 420 نانومتر و کم ترین جذب نوری در 550 نانومتر می­باشد.
 نتایج آنالیز تبدیل فوریه مادون‌قرمز (FTIR)
در مورد محلول­های موردنظر خصوصیت­های بیش­تر نانوذره­های نقره تولیدی با استفاده از طیف‌سنجی تبدیل فوریه مادون‌قرمز از نمونه­های مایع شفاف باکتری­ها که با نیترات نقره 001/0 مولار تیمار شد­ه­بود و سپس در نور به رنگ خرمایی تغییر داده بود توسط دستگاهFTIR ، جذب باندها در نواحی ذیل گزارش شد :)تصویر7-4)
a″2= 3463, 2065, 1634, 546 cm-1
D= 3463, 2065, 1635, 547 cm-1
y2= 3462, 2066, 1635, 556cm-1
y7= 3463, 2065, 1636, 547cm -1
 
نتایج تصویربرداری میکروسکوپ الکترونی TEM
 نتایج و تصاویر میکروسکوپ الکترونی گذاره نشان‌دهنده­ی حضور نانوذره­های نقره بوده که اندازه­ی آن­ها متغیر بوده و دارای شکل کروی و بدون چسبندگی (غیر آگریگه) به یکدیگر بوده که پوشش پروتئینی اطراف آن­ها نیز قابل‌مشاهده است (تصویر2)
شناسایی میکروارگانیسم به روش تعیین ترادف ژن 16S rRNA
 تصویر ژل آگارز حاصل از تکثیر ژن 16S rRNA سویه­های موردنظر در تصویر 1 آورده شده است. هم‌چنین محصول­های PCR با استفاده از روش سانگر و توسط شرکت ژن فن آوران تعیین توالی گردید. نتایج حاصل از تعیین توالی نشان داد که با  ایدینتیتی[8] بالای 98%  این سویه احتمالا مربوط به جنس مارینوباکتر سویه np-4 با اگزشن نامبر kt763388.1[9] می­باشد.
 
 
درخت فیلوژنتیک
درخت فیلوژنی از سویه­ی برتر با نام مارینو باکتر سویه np-4 ترسیم گردید. ارزش بوت استرپ با بیان درصد از 1000 تکرار در بالای شاخه‌ها نشان داده‌شده است و شاخه‌های بالای50 درصد ارزش قابل استناد محسوب شد.
 
نتایج حاصل از آزمون سنجش حساسیت میکروبی به نانوذرات نقره تولیدی
 نتایج آزمون حساسیت میکروبی به نانوذرات نقره تولیدی درروش رقت­سازی لوله­ای بر سویه­های موردنظر در جدول 5 ذکرشده است.
بحث
تولید نانوذره­های فلزی و نانو ساختارها به علت خواص نوری، شیمیایی، فتوشیمیایی و الکتریکی غیرمعمولی که دارند، جالب‌توجه است. فلزهایی مانند نقره و طلا که رزونانس پلاسمون سطحی قوی دارند بسیار حایز اهمیت هستند. ذره­های نانو کریستالی نقره کاربردهای عمده‌ای در تشخیص­های بیومولکولی بسیار حساس، خواص ضدمیکروبی، درمان، کاتالیز و ساخت سنسورها دارند (16). نانوذره­های نقره از طریق موجودهای زنده مانند میکروارگانیسم­ها از قبیل قارچ­ها، باکتری­ها، مخمرها و یا ماکروارگانیسم­ها مانند گیاهان، جلبک­ها و غیره سنتز می­شود (17)که استفاده از میکروارگانیسم­های مختلف یک پروتکل کم‌هزینه و سازگار با محیط‌ زیست برای سنتز نانوذره­های نقره است ؛ با توجه به مشکل­های عمده‌ای که در روش­های فیزیکی و شیمیایی برای تولید نانوذره وجود دارد نیاز به روش­هایی آسان، کم‌هزینه، ایمن، غیرسمی و  سازگار با محیط‌زیست وجود دارد (16). رسوب های دریایی به­طور معمول حاوی یک مخزن از کربن آلی و مواد مغذی ضروری است و فرض بر این است که فعالیت­های آنزیمی در رسوب های دریایی نسبت به آب دریا افزایش می یابد (18).
در این تحقیق تولید نانوذره­ها توسط میکروارگانیسم‌ها نشان داده‌شده است. در مرحله­ی اول بر روی محیط پایه پلیت کانت که درصد بالایی از میکروارگانیسم‌ها بر روی این محیط رشد می­کنند تعداد 39 کلنی خالص شد. در مرحله بعد از محیط کشت زوبل مارین آگار که محیط کشت اختصاصی برای رشد باکتری­های دریایی است و به تقلید از آب دریا فرموله شده ­است استفاده شد که تعداد 16کلنی خالص شد و از محیط کشت تهیه شده از تلفیق نوترینت براث و زوبل مارین براث با آب دریا نیز 27 کلنی جدا شد.
مشکل بزرگ سنتز  نانوذره­ها بر پایه­ی بیولوژیک، سرعت‌پایین آن است اما در این‌گونه باکتری­ها در عرض چند ثانیه از مایع شفاف رویی و در عرض 24 تا 48 ساعت از توده زیستی باکتری نانوذره­های نقره شروع به تولید و سنتز می­کند و تغییر رنگ از زرد به قهوه‌ای یا خرمایی صورت می­گیرد و این رنگ پایدار است و حتی بعد از گذشت 40-30 روز یا بیش­تر و این نانوذره­ها نیاز به پایدارکننده ندارد در بعضی موارد تولید نانوذره­ها توسط عصاره­ی گیاهان ناپایداری مشاهده می‌شود که باید توسط مواد شیمیایی یا عصاره­های زیستی پایدار شوند (22). نتایج حاصل از این پژوهش با نتایج حاصل از پژوهش Malarcodi و همکاران در سال 2013 (19) و Sechardi و همکاران در سال 2012 کاملاً مشابه بود (19). طیف­های اسپکتوفتومتری UV-Vis به‌طور کامل نشان‌دهنده افزایش ارتعاش­های پلاسمون رزونانس سطحی در طول‌موج 420  نانومتر است که برای همه‌سویه‌ها طول‌موج 420 نانومتر اوج پیک نانوذره­ها است که نشان‌دهنده­ی پیک نانوذره­های نقره است که با نتایج کار حاصل از پژوهش Shivakrishna  و همکاران در هندوستان در سال 2013 و Sechardi و همکاران در سال 2012 به­طور کامل مشابه بوده­است (20 و 21).
در بین نمونه­های دریایی 4 نمونه که رنگ خرمایی پررنگ­تر داشتند و سرعت به تر و بیش­تری در تولید نانوذره­های نقره نشان دادند برای آنالیز FTIR انتخاب شدند. نتایج حاصل از پیک اثبات کننده حفظ ساختار دوم پروتئین­ها پس از برهم‌کنش با نانوذره­ها است. بنابراین پروتئین­های حاصل از باکتری­ها نه‌تنها عامل احیای یون نقره­اند، بلکه این پروتئین­ها اطراف نانوذره­ها را فراگرفته­اند و مانع از تجمع و آلگومره شدن نانوذره­ها شده­اند که این نتایج با نتایج Dee pa و همکاران در هندوستان در سال 2013 (22) و Yokesh Babu و همکاران در سال 2013 در هندوستان (23) مشابهت و هم­خوانی داشت.
پس از ظهور و افزایش مقاومت باکتری­ها و دیگر میکروارگانیسم­ها به آنتی‌بیوتیک‌ها تحقیق­های بسیاری در سطح آزمایشگاهی برای کشف مواد جایگزین آنتی‌بیوتیک‌ها انجام‌شده است. نقره در فرم یونی یا در ابعاد خاص خاصیت ضدمیکروبی بالایی داشته و می­تواند برای کنترل میکروب­های بیماری­زا نسبت به آنتی‌بیوتیک‌ها کاربرد داشته باشد(24). در تحقیق اخیر اشرشیا کلی و سودوموناس آئروژینوزا در رقت­هایmg/ml  16/1به‌عنوان کم­ترین غلظت مهاری، کاندیدا آلبیکنز رقت mg/ml  8/1 به‌عنوان کم­ترین غلظت مهاری، باسیلوس سرئوس و استافیلوکوکوس ارئوس رقت mg/ml  4/1 به‌عنوان کم­ترین غلظت مهاری در نظر گرفته شد و نتیجه­ی اثر ضدمیکروبی نانوذره­های سنتز شده توسط باکتری که با نتایج حاصل از کار Yokesh Babu و همکاران (23) در سال 2013 هم­خوانی داشت که تحقیق­های مشابه بر روی دیسک­های دیفیوژن این تست انجام‌شده بود ولی این تحقیق بر روش رقت­سازی لوله­ای و تعیین  کم­ترین غلظت مهاری و کم­ترین غلظت کشندگی انجام گرفت که از دقت و اطمینان بیش­تری برخوردار است.
تصاویر به­دست آمده از میکروسکوپ الکترونی گذاره نشان می­دهد که گستر­ه­ی اندازه­ی نانوذره­ها در محدوده­ی 88-19/2 نانومتر کروی[10]  و پوشش پروتئینی در اطراف آن­ها است. بنابراین پروتئین­های باکتریایی نه‌تنها عامل احیای یون نقره‌اند بلکه یک سری از این پروتئین­ها اطراف نانوذره­ها را فراگرفته‌اند و عامل پایداری و مانع چسبندگی و تجمع[11] نانوذره­ها می­گردند و این ذره­ها حتی بعد از گذشت 50-40 روز پایداری[12] خود را حفظ کردند. مزیت ارزیابی باکتری­های جداشده از خلیج‌فارس در تولید نانوذره­های نقره در این است که در این خصوص قبلا کاری صورت نگرفته است.
نتیجه‌گیری
به‌طورکلی نتایج حاصل از این پژوهش نشان داد که باکتری­های جدا شده با منبع دریایی و درصد بالایی از باکتری­های غیردریایی از خلیج‌فارس قادر به تولید نانوذره­های نقره به‌­صورت درون و برون سلولی می­باشند که این عمل با استفاده از آنزیم­ها و پروتئین­ها که باکتری­ها به محیط ترشح می­کنند، صورت می­گیرد و نیاز به استخراج نداشته و بدون داشتن هزینه و مشکل­های ناشی از استخراج می­توانند مورداستفاده قرار گیرند.
سپاسگزاری
از کلیه­ی مسئولین محترم دانشگاه آزاد اسلامی واحد کرمان آزمایشگاه تحقیقاتی پاسارگاد (تهران) که در انجام کارهای آزمایشگاهی و تهیه­ی نمونه­های این تحقیق کمال همکاری و مساعدت لازم را مبذول فرموده­اند، سپاسگزاری فراوان می­گردد.
 
جدول 2- نتایج تولید نانوذره های نقره تولیدی توسط روماند و بیومس جدایه های بدست آمده
نام جدایه مایع رویی در نور تولید
رنگ خرمایی
مایع
رویی در
تاریکی
بیومس در
نور
بیومس در
تاریکی
T2 +
S1 +
a1 +
a 1 +
a 1 + +
D + +
g"1 +
2Y + +
7Y + + +
 
 
 
 
جدول 3 - نتایج تولید نانوذره های نقره تولیدی توسط روماند جدایه های با منبع غیر دریایی
نام جدایه نمونه ها رشد یافته
g3 +
F1 +
N1 +
D2 +
B8 +
 
 
جدول 4 - نتایج اندازه گیری جذب نوری نانوذره های سنتز شده در طول موج های مختلف
طول موج(nm)
 
نام جدایه
350 400 420 450 500 550
T2 648/0 674/0 830/0 79/0 634/0 452/0
S1 656/0 684/0 855/0 845/0 774/0 656/0
a1 642/0 622/0 722/0 650/0 514/0 370/0
a 1 656/0 666/0 808/0 756/0 622/0 480/0
a 1 650/0 680/0 845/0 820/0 669/0 438/0
D 644/0 668/0 820/0 780/0 626/0 442/0
g"1 658/0 684/0 855/0 835/0 796/0 798/0
2Y 640/0 662/0 808/0 764/0 598/0 396/0
7Y 658/0 690/0 875/0 865/0 645/0 440/0
 
 
 
جدول 5- حداقل غلظت ممانعت کنندگی نانوذره ها بر سویه های مورد نظر
نام میکروارگانیسم حداقل غلظت ممانعت
کنندگی(MIC)
کاندیدا آلبیکنز 8/1 (میلی گرم بر میلی لیتر)
اشریشیا کلی 16/1 (میلی گرم بر میلی لیتر)
انتروکوکوس فکالیس 4/1 (میلی گرم بر میلی لیتر)
سودوموناس آئروژینوزا 16/1 (میلی گرم بر میلی لیتر)
باسیلوس سرئوس 4/1 (میلی گرم بر میلی لیتر)
استافیلوکوکوس ارئوس 4/1 (میلی گرم بر میلی لیتر)
 

 
تصویر1: ژل آگارز حاصل از تکثیر ژن 16S rRNA ایزوله های مورد نظر. باند M؛ سایز مارکرbp DNA size marker  100 (فرمنتاز)، باندC+؛ کنترل مثبت (سودوموناس آئروژینوزا ATCC 15442)، باند 1؛  ایزوله مورد نظر با طول باند bp 1500، باندC-؛ کنترل منفی (آب مقطر)
 
 
 

 
تصویر2: تصاویر میکروسکوپ الکترونی TEM مربوط به نانوذره های سنتز شده در دو مقیاس (کروی و بدون چسبندگی) 
 
 
 
 
 
 

تصویر 3. درخت فیلوژنی از سویه برتر با نام مارینوباکتر np-4
 

 
تصویر 5 طیف جذبیFTIR از نمونه d 
                                                                                                                                                                                              تصویر 4 طیف جذبیFTIRاز نمونه a”2
 
                                                                                                                                      
 
 
 
 تصویر 7 طیف جذبیFTIRاز نمونه y7
 

                                                                                                                                                                             تصویر 6 طیف جذبیFTIRاز نمونه y2
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
                                                                                
 
منابع
1. Moharrer S., Mohammadi B., Gharamohammadi RA, Yargoli M. Biological synthesis of silver nanoparticles by Aspergillus flavus, isolated from soil of Ahar copper mine. Indi J sci tech. 2012. 5(S3):2443-4.                                                                                              
2. Souza GIH, Macato PD, Duran N, Esposito E. Utilization of Fusarium oxysporum in the biosynthesis of silver nanoparticles and its antibacterial activities. In: Proceed .IX Nation Meet . Enviro Micrib, 2004:25.
3. Sharma VK, Yangard RA, Lin Y. Silver nanoparticles: Green synthesis and their antimicrobial activities. Adv Colloid Interface Sci, 2009, 145(1-2):83-96.
4 .Haefeli C, Franklin C, Hardy K. Plasmid-determined silver resistance in Pseudomonas stutzeri isolated from a silver mine. J Bacter, 1984. 158(1):389-92.
5. Mandal D, Bolander ME, Mukhopadhyay D, Sarkar G, Mukherjee P.


Export as: HTML | XML | RSS

© 2020 All Rights Reserved | New Cellular and Molecular Biotechnology Journal

Designed & Developed by : Yektaweb